View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19895_high_14 (Length: 283)
Name: NF19895_high_14
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19895_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 23 - 268
Target Start/End: Original strand, 16859868 - 16860113
Alignment:
| Q |
23 |
cctacttgtgtatgatttcatggctaaaggaagcttagaccggtagttttttgatgaggcaaaatccaacttttctatcacattgtattttgtctgagtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16859868 |
cctacttgtgtatgatttcatggctaaaggaagcttagactggtagttttttgatgaggcaaaatccaacttatctatcacattgtattttgtctgagtg |
16859967 |
T |
 |
| Q |
123 |
tgtggatgagaatggaggctcgtaggttgtgattctctctggagccatgaaacgacagcgcatgctgctaggttgatggaagaggtagagggatttgagg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16859968 |
tgtggatgagaatggaggctcgtaggttgtgatactctctggagccatgaaacgacagcgcatgctgctaggttgatggaagaggtagagggatttgagg |
16860067 |
T |
 |
| Q |
223 |
agtgcgtgttaatgcaggtctcggtaaaatgattgaccatctctct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16860068 |
agtgcgtgttaatgcaggtctcggtaaaatgattgatcatctctct |
16860113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 15627549 - 15627498
Alignment:
| Q |
10 |
gcaaaggtgacctcctacttgtgtatgatttcatggctaaaggaagcttaga |
61 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
15627549 |
gcaaaggcgacctgctacttgtgtatgacttcatggctaatggaagcttaga |
15627498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 22934125 - 22934169
Alignment:
| Q |
18 |
gacctcctacttgtgtatgatttcatggctaaaggaagcttagac |
62 |
Q |
| |
|
||||||||||||||||| ||||||||| | || |||||||||||| |
|
|
| T |
22934125 |
gacctcctacttgtgtacgatttcatgtcaaatggaagcttagac |
22934169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University