View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19895_high_16 (Length: 245)
Name: NF19895_high_16
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19895_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33903431 - 33903669
Alignment:
| Q |
1 |
ctgatgttatatttgtgccannnnnnncatctttgacttataacagacactccaaaacaggtccacatgaaaggaggagtagaaacaaggtgttgcaaga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903431 |
ctgatgttatatttgtgccatttttttcatctttgacttataacagacactccaaaacaggtccacatgaaaggaggagtagaaacaaggtgttgcaaga |
33903530 |
T |
 |
| Q |
101 |
gaagttggtgaggtatttgatgagtcaagaggaatggaagaggtcaggtggaagggatcatttgatcttggctcatcatcctaatagtatgttggatgct |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903531 |
gaagttggtgaggtatttgatgaatcaagaggaatggaagaggtcaggtggaagggatcatttgatcttggctcatcatcctaatagtatgttggatgct |
33903630 |
T |
 |
| Q |
201 |
agaatgaaactttggcctgcaacttttatattgtctgat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903631 |
agaatgaaactttggcctgcaacttttatattgtctgat |
33903669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 96 - 230
Target Start/End: Complemental strand, 9327639 - 9327505
Alignment:
| Q |
96 |
caagagaagttggtgaggtatttgatgagtcaagaggaatggaagaggtcaggtggaagggatcatttgatcttggctcatcatcctaatagtatgttgg |
195 |
Q |
| |
|
|||||| ||||||||| |||| ||| ||||||||||||||| |||||| |||| |||||| |||| | || |||||||||||||||||||||| |
|
|
| T |
9327639 |
caagaggagttggtgaagtatgtgacatctcaagaggaatggaaaaggtcaaagggaaaagatcatgtgattatagcacatcatcctaatagtatgttgg |
9327540 |
T |
 |
| Q |
196 |
atgctagaatgaaactttggcctgcaacttttata |
230 |
Q |
| |
|
|||| ||||||||| | ||||| || || |||||| |
|
|
| T |
9327539 |
atgcaagaatgaaattgtggccagctacatttata |
9327505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University