View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19895_high_19 (Length: 222)
Name: NF19895_high_19
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19895_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 6421222 - 6421332
Alignment:
| Q |
1 |
aagcttagtaaattgtctcagagattgaagtcttgaaacatggcaccgtttgctatgacgattttctattcatctagcgaattctagagatttagtgacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6421222 |
aagcttagtaaattgtctcagagattgaagtcttgaaacatggcaccgtttgctatgacgattttctattcatctagcgaattctagagatttagtgacc |
6421321 |
T |
|
| Q |
101 |
cacatggatga |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
6421322 |
cacatggatga |
6421332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 6421327 - 6421376
Alignment:
| Q |
129 |
ggatgaagaaatcacaatttcgccaagcaaacggtcactttcaagaaact |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6421327 |
ggatgaagaaatcacaatttcgccaagcaaacggtcacttttaagaaact |
6421376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University