View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19895_high_19 (Length: 222)

Name: NF19895_high_19
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19895_high_19
NF19895_high_19
[»] chr5 (2 HSPs)
chr5 (1-111)||(6421222-6421332)
chr5 (129-178)||(6421327-6421376)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 6421222 - 6421332
Alignment:
1 aagcttagtaaattgtctcagagattgaagtcttgaaacatggcaccgtttgctatgacgattttctattcatctagcgaattctagagatttagtgacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6421222 aagcttagtaaattgtctcagagattgaagtcttgaaacatggcaccgtttgctatgacgattttctattcatctagcgaattctagagatttagtgacc 6421321  T
101 cacatggatga 111  Q
    |||||||||||    
6421322 cacatggatga 6421332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 6421327 - 6421376
Alignment:
129 ggatgaagaaatcacaatttcgccaagcaaacggtcactttcaagaaact 178  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||    
6421327 ggatgaagaaatcacaatttcgccaagcaaacggtcacttttaagaaact 6421376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University