View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19895_low_21 (Length: 233)
Name: NF19895_low_21
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19895_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 43097578 - 43097375
Alignment:
| Q |
19 |
ggtacaaatctccagcttagcagcaacacatgacaccaaacattgttctaagatgtttcctaagcacgacacaacaagatgcatgcatagtcagattttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43097578 |
ggtacaaatctccagcttagcagcaacacatgacaccaaacattgttctgagatgtttcctaagcacgacacaacaagatgcatgcatagtcagatgttg |
43097479 |
T |
|
| Q |
119 |
taatttcgccatcgtagttaagcttcatccaactcgtatttggaggataaaaaggaattacttgacacctatcgtgtga---tccttatacatgtaagta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
43097478 |
taatttcgccatcgtagttaagcttcatccaactcgtatttggaggataaaaaagaattacttcacacctatcgtgtgatcttctttatacatgtaagta |
43097379 |
T |
|
| Q |
216 |
ttat |
219 |
Q |
| |
|
|||| |
|
|
| T |
43097378 |
ttat |
43097375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University