View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19895_low_23 (Length: 209)
Name: NF19895_low_23
Description: NF19895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19895_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 31 - 157
Target Start/End: Complemental strand, 39607816 - 39607690
Alignment:
| Q |
31 |
gtatttatgtaaaataaaataaaatttgaagaatgtaannnnnnnnattaaattatgtaaattacttcatatttgtttgacaacaacattattatctatc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39607816 |
gtatttatgtaaaataaaataaaatttgaagaatgtaatttcttttattaaattatgtagattacttcatatttgtttgacaacaacattattatctatc |
39607717 |
T |
|
| Q |
131 |
gaacatataatttctttatgcttttct |
157 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39607716 |
gaacatataatttctttatgcttttct |
39607690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University