View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19896_high_13 (Length: 214)
Name: NF19896_high_13
Description: NF19896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19896_high_13 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 72 - 214
Target Start/End: Original strand, 46052301 - 46052443
Alignment:
| Q |
72 |
tcatttgtttttcacagaaatggaagtaaccctatttaaatggacatggtagggtaactttcacccatactcctccaacgggccgccgctccaacctccg |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46052301 |
tcatttgtttttcacagaaatggaagtaaccctatttaaatggacatggtagggtaactttcacccatactcctccaacgggccgccactccaacctccg |
46052400 |
T |
|
| Q |
172 |
ccaaaatctgtactcaaaccattgaaattgaaatctttgcttt |
214 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46052401 |
ccaagatctgcactcaaaccattgaaattgaaatctttgcttt |
46052443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 46052245 - 46052282
Alignment:
| Q |
16 |
aacttctctactgctgtctctctctccagtctccaagt |
53 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46052245 |
aacttctctactgctatctctctctccagtctccaagt |
46052282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University