View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19897_low_23 (Length: 369)
Name: NF19897_low_23
Description: NF19897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19897_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 18 - 366
Target Start/End: Complemental strand, 1248339 - 1247991
Alignment:
| Q |
18 |
acttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctggcaaccctaggaccgacgaaagtgacgctccagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248339 |
acttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctggcaaccctaggaccgacgaaagtgacgctccagt |
1248240 |
T |
 |
| Q |
118 |
ccctgtccccgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctgaggagaccgttaaggcctccgacgataagtctcta |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1248239 |
ccctgtccctgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctgaggagaccgttaaggcctctgacgataagtctcta |
1248140 |
T |
 |
| Q |
218 |
ggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgatattgaatatccaacaccatatagttnnnnnnntga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1248139 |
ggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgatattgaatatccaacaccatatagttaaaaaaatga |
1248040 |
T |
 |
| Q |
318 |
ctaagtataaaatagtcattcgtgaaattttcggtattcttctctctcg |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
1248039 |
ctaagtataaaatagtcattcgtgaaattttcggtattgttatctctcg |
1247991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University