View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19897_low_39 (Length: 231)
Name: NF19897_low_39
Description: NF19897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19897_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 5910621 - 5910821
Alignment:
| Q |
20 |
aatacgattcaatttctgaatgaattaatgaaatgaattagagattggttatnnnnnnnttgaatgataccatttgatgaatttt--gtgaaaaacatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
5910621 |
aatacgattcaatttctgaatgaattaatgaaatgaattagagattggttataaaaaaattgaatgataccatttgatgaattttttgtgaaaagcatct |
5910720 |
T |
|
| Q |
118 |
aatttaatgtttgaaaacaacctgtttt-ttgttattttctgttatgattgttactttcaattgttaagaaagtgtttattttccaacattgatgtctgt |
216 |
Q |
| |
|
||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5910721 |
aatataatggttgaaaacaacctgtttttttgttattttctgttatgattgttactttcaattgttaagaaagtgtttattttccaacattgatgtctgt |
5910820 |
T |
|
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
5910821 |
g |
5910821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University