View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19897_low_40 (Length: 215)
Name: NF19897_low_40
Description: NF19897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19897_low_40 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 32787574 - 32787376
Alignment:
| Q |
16 |
atgttgtcccaatcgaggatatttcatgctaccaatcattaagggaacacaatggcatgcaaggtataattataaaatcacatatttttctatttttcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
32787574 |
atgttgtcccaatcgaggatatttcatgctaccaaacattaagggaacacaatggcatgcaaggtatacttataaaatcacatatttttctatttttaat |
32787475 |
T |
 |
| Q |
116 |
tattaaataatttatctaacaatataattgtttttactttcgtcagaatatgagcggcacaataacaacgttgaacaaaatgacaatgatgtcgatgaat |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32787474 |
tattaa-taatttatctaacaatataattgtttttactttcgtcagaatatgagcggcacaataacaacgttgaacaaaatgacaatgatgtcgatgaat |
32787376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University