View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19897_low_41 (Length: 213)
Name: NF19897_low_41
Description: NF19897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19897_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 22 - 202
Target Start/End: Complemental strand, 34533182 - 34533002
Alignment:
| Q |
22 |
atgccgtacaagacattacacattcaaagctttaatgtacataatagatgtttgtgattcgatgaaaacctaaaacagcgaaggattattacattagcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533182 |
atgccgtacaagacattacacattcaaagctttaatgtacataatagatgtttgtgatacgatgaaaacctaaaacagcgaaggattattacattagcaa |
34533083 |
T |
 |
| Q |
122 |
acacgcatgtggtttgaacactgtaaatattcatccaaattcttaatttaacgtaggagtctattcacttgtatatatatt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533082 |
acacacatgtggtttgaacactgtaaatattcatccaaattcttaatttaacgtaggagtctattcacttgtatatatatt |
34533002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University