View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_high_37 (Length: 302)
Name: NF19898_high_37
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 298
Target Start/End: Complemental strand, 33985569 - 33985289
Alignment:
| Q |
16 |
attgttacttgcaggtgaaaaatggtggtgagtattcgattagcaagacttggatgcacacacaacccattttatcgggttgttgttactgacagcaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985569 |
attgttacttgcaggtgaaaaatggtggtgagtattcgattagcaagacttggatgcacacacaacccattttatcgggttgttgttactgacagcaaat |
33985470 |
T |
 |
| Q |
116 |
gtgctagagatggcaagaacatcgaagttgttggttactacaatccccttgcaggttcaacatcaattctttaaccttatctgtaattctatatgttttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985469 |
gtgctagagatggcaagaacatcgaagttgttggttactacaatccccttgcaggttcaacatcaattctttaaccttatctgtaattctatatgttttt |
33985370 |
T |
 |
| Q |
216 |
tatgctcaaactttacttgttcaaaataaattttgtaatttatgttattcaaaatttgcatttttattatttgatgatgtcca |
298 |
Q |
| |
|
|||||||||| ||||||||||| || | ||||||||||||||||||| |||| |||||||||||||||||| |||| |||| |
|
|
| T |
33985369 |
tatgctcaaattttacttgttc-aatttttttttgtaatttatgttatt-aaaaattgcatttttattatttggtgatatcca |
33985289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University