View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_high_40 (Length: 293)
Name: NF19898_high_40
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 34730640 - 34730457
Alignment:
| Q |
17 |
agaactagaaataatgtgatggtggaattggactggttagtggacagtggttaccatgtcggcttgttgaacaatgatctttcatttcagctaattacca |
116 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34730640 |
agaactagaagtaatgtcatggtggaattggactggttagtggacagtggttaccatgtcggattgttgaacaatgatttttcatttcagctaattacca |
34730541 |
T |
|
| Q |
117 |
tgaattctctgtctttggggccacttgatacgacccactagggccaagaaagaaccttataaatttggaagaaatctttttaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34730540 |
tgaattctctgtctttggggccacttgatacgacccactagggccaagaaagaaccttataaatttggaagaaatctttttaat |
34730457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 201 - 274
Target Start/End: Complemental strand, 34730099 - 34730026
Alignment:
| Q |
201 |
tttcagttgttgtattgattcactattagtggaagaatcaaaacctgacattgctgcatgtcatgatgcgtaga |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34730099 |
tttcagttgttgtattgattcactattagtggaagaatcaaaacctgacattgctgcatgtcctgatgcgtaga |
34730026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University