View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_high_41 (Length: 290)
Name: NF19898_high_41
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 53675973 - 53676247
Alignment:
| Q |
1 |
catgtatatcattttatcttgtcttgttatataagccaaaaatgaacctcctttttacaaaattttgtgcctttattatttttagtttt---------ac |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53675973 |
catgtatatcattttatcttgtcttgttatataagccaaaaatgaacctcctttttacaaaattttgtgcctttattatttttagtttttttttttttac |
53676072 |
T |
|
| Q |
92 |
ttccagttggtaggaaagcttgttggactatttgcaattcttgnnnnnnntagttacagtcatcactttatcatcaatgaaactttgagaggacactaac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676073 |
ttccagttggtaggaaagcttgttggactatttgcaattcttgaaaaaaatagttacattcatcactttatcatcaatgaaactttgagaggacactaac |
53676172 |
T |
|
| Q |
192 |
tgttttctctttttctgatggatgataaagtggaaaatatttctgtctctaactaccaaaccttgcaaggttgccac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
53676173 |
tgttttctctttttctgatggatgataaagtggaaaatatttctgtctctaa--atcaaaccttgcaaggttgccac |
53676247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University