View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_high_60 (Length: 236)
Name: NF19898_high_60
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_high_60 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 29197653 - 29197873
Alignment:
| Q |
16 |
gcaagtacaccgcttaggttgtttgcaagtacagtaattgcaagttgattcacaggtttctacaatatctagacattggcacataacaggaatccattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29197653 |
gcaagtacaccgcttaggttgtttgcaagtacagtatttgcaagttgattcacaggtttctacaatatctagacattggcacataataggaatccattca |
29197752 |
T |
 |
| Q |
116 |
acatagaaccattcaacattcttacagcacctgttggttgtcgagttgacatcattggaggagatcacttgagtgatgaaggattttgaatcaaaacgag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29197753 |
acatagaaccattcaacattcttacagcacctgttggttgtcgagttgacatcattggaggagatcacttgagtgatgaaggattttgaatcaaaacgag |
29197852 |
T |
 |
| Q |
216 |
catcaatagttgcaatgaagc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29197853 |
catcaatagttgcaatgaagc |
29197873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 29202209 - 29202289
Alignment:
| Q |
16 |
gcaagtacaccgcttaggttgtttgcaagtacagtaattgcaagttgattcacaggtttctacaatatctagacattggca |
96 |
Q |
| |
|
|||| ||||| | ||||||||||| |||||||| | ||||| |||||||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
29202209 |
gcaactacactgtttaggttgtttacaagtacactttttgcaggttgattcgcaggtttctgcaatatctacacattggca |
29202289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 29153640 - 29153685
Alignment:
| Q |
176 |
gagatcacttgagtgatgaaggattttgaatcaaaacgagcatcaa |
221 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
29153640 |
gagatcacttgagttatgaaggatgttgaatcgaaacgagcatcaa |
29153685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University