View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_low_33 (Length: 338)
Name: NF19898_low_33
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 48886984 - 48887303
Alignment:
| Q |
1 |
gctcatgtgaccaaggaaattgtatggaaattcttttgatnnnnnnncttgtaattctatggatgctggttaattacatttttaaatttcaactactcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48886984 |
gctcatgtgaccaaggaaattgtatggaaattcttttgataaaaaaacttgtaattctatggatgctggttaattacatttttaaatttcaactactcta |
48887083 |
T |
 |
| Q |
101 |
tggcatctaaggtttccaccacttagcagagctaaatacatcagttatcatgtctccgtctaccctgtatgatttagatggatgtaatgtaaccatttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48887084 |
tggcatctaaggtttccaccacttagcagagctaaacacatcagctatcatgtctccgtctaccctgtatgatttagatggatgtaatgtaaccatttga |
48887183 |
T |
 |
| Q |
201 |
tttcctaacttgtttgagtattttaaatatattttttgcagtaaggcttgaatttaaattaccatattgtcagattaattcctctttacttggaagaatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48887184 |
tttcctaacttgtttgagtattttaaatatattttttgcagtaaggcttgaatttaaattaccatattgtcagattaattcctctttacttggaagaatt |
48887283 |
T |
 |
| Q |
301 |
gactaattgcatgcatgggt |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48887284 |
gactaattgcatgcatgggt |
48887303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University