View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_low_52 (Length: 250)
Name: NF19898_low_52
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_low_52 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 45 - 250
Target Start/End: Complemental strand, 4092812 - 4092611
Alignment:
| Q |
45 |
gagtaacgtacgcgtgcacgggtactttaccatatttggaataccgtcccattcttcagaggtaggggccaatgtttcatagtgcagaggcttgtatgtc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4092812 |
gagtaacgtacgcgtgcacgggtactttaccatatttggaatacc----cattcttcagaggtaggggccaatgtgtcatagtgcagaggcttgtatgtc |
4092717 |
T |
|
| Q |
145 |
caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttcttttcacttgaaaatagaatgtgtgtaaaataaattcgtctatatcatca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4092716 |
caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttcttttcacttgaaaatagaacgtgtgtaaaataaattcgtctatatcatca |
4092617 |
T |
|
| Q |
245 |
ttcata |
250 |
Q |
| |
|
|||||| |
|
|
| T |
4092616 |
ttcata |
4092611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University