View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19898_low_53 (Length: 249)
Name: NF19898_low_53
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19898_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 29197996 - 29198097
Alignment:
| Q |
1 |
atgtatggctctatttataatggagtgcaataagggctataagggtcttgtttttcaattcttaggaggtataccacataaatattataaagtagaatat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29197996 |
atgtctggctctatttataatggagtgcaataagggctataagggtcttgtttttcaattcataggaggtataccac----atattataaagtagaatat |
29198091 |
T |
 |
| Q |
101 |
gataat |
106 |
Q |
| |
|
|||||| |
|
|
| T |
29198092 |
gataat |
29198097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 196 - 238
Target Start/End: Original strand, 29198191 - 29198233
Alignment:
| Q |
196 |
cgtagccgacttctgttgtcggattatggagaatcttattcat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29198191 |
cgtagccgacttctgttgtcggattatggagaatcttattcat |
29198233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University