View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19898_low_69 (Length: 202)

Name: NF19898_low_69
Description: NF19898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19898_low_69
NF19898_low_69
[»] chr8 (1 HSPs)
chr8 (25-95)||(27529866-27529936)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 25 - 95
Target Start/End: Complemental strand, 27529936 - 27529866
Alignment:
25 atggtgttttttgtactttttagggcttgtatatatattttgaatggctttggtacctcttctttgcccta 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27529936 atggtgttttttgtactttttagggcttgtatatatattttgaatggctttggtacctcttctttgcccta 27529866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University