View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19900_low_1 (Length: 317)
Name: NF19900_low_1
Description: NF19900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19900_low_1 |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 108)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 2 - 176
Target Start/End: Original strand, 30179323 - 30179501
Alignment:
| Q |
2 |
ttaacatgtgactgattttatttgagtgagattatttcaaagattttttgagtgatgaaattggatcctagatgatagatacctttgtcgttggtaaca- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30179323 |
ttaacatgtgactgattttatttgagtgagattatttcaaagattttttgagtgatgaaattggatcctagatgatagatacctttgtctttggtaacaa |
30179422 |
T |
 |
| Q |
101 |
---agttatggtcgtaggtaaagtgaccgaaggttttgacctgtaaaagaaattagaatgctttggtttttaaaaataa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30179423 |
gttagttatggtcgtaggtaaagtgaccgaaggttttgacctgtaaaagaaattagaatgctttggttcttaaaaataa |
30179501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 168 - 227
Target Start/End: Original strand, 35837915 - 35837974
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| |||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
35837915 |
taaaaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35837974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 229
Target Start/End: Complemental strand, 48359074 - 48359023
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc |
48359023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 19561449 - 19561395
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 23817033 - 23816979
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
23817033 |
gctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35210514 - 35210460
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 39832907 - 39832961
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39832961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 44344788 - 44344734
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
44344734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 6108322 - 6108391
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||| | || ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
6108322 |
ttttaaataaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 13769775 - 13769824
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct |
18022421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 44403248 - 44403199
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
44403199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 1006836 - 1006892
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 23399985 - 23399921
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
23399985 |
taaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 27458390 - 27458454
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
27458390 |
taaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 44508721 - 44508777
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 44509053 - 44508997
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 232
Target Start/End: Complemental strand, 13770085 - 13770026
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| | |||||||||||||||||||| |
|
|
| T |
13770085 |
ataaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 229
Target Start/End: Original strand, 19561155 - 19561206
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
19561206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
34877824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 181 - 232
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
181 |
aaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 37953048 - 37953001
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagt |
37953001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 176 - 227
Target Start/End: Original strand, 43300611 - 43300662
Alignment:
| Q |
176 |
atgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
43300611 |
atgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt |
43300662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1614560 - 1614614
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
1614560 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1974010 - 1974064
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5308324 - 5308378
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5354769 - 5354823
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 8144296 - 8144350
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10358367 - 10358313
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 12894401 - 12894347
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 17999720 - 17999666
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
17999666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19757749 - 19757803
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25092161 - 25092215
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25547489 - 25547435
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25547435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25988386 - 25988440
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 28911905 - 28911851
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 30223799 - 30223745
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
30223799 |
ataaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagt |
30223745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35838336 - 35838282
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 37372903 - 37372849
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctg |
37372849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 39520399 - 39520453
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 7431952 - 7432001
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7432001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 19783816 - 19783865
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
19783865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 23816671 - 23816720
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
23816720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 30709643 - 30709594
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
30709594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||||||||||||| |||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 38486479 - 38486532
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
||||||||||| |||| |||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
38486479 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcct |
38486532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 39438742 - 39438791
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| ||||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
39438791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 46759659 - 46759708
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
46759708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 8555811 - 8555751
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
8555811 |
ttttaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 31732450 - 31732402
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| |||||| |
|
|
| T |
31732450 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 35015219 - 35015163
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
35015163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 45021855 - 45021799
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||||| |||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggt |
45021799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 45073650 - 45073586
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||| |||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
45073650 |
taaaaagaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45073586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 6079801 - 6079864
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || ||||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
6079801 |
aaaaaaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 31503780 - 31503733
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
31503733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 173 - 232
Target Start/End: Complemental strand, 45228922 - 45228863
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
45228922 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 46828936 - 46828999
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||| |||||||||||||||| |||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
46828936 |
aaaattaaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 1614903 - 1614849
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3807865 - 3807919
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| ||||| || | || ||||||||||||||||||||||||||||| |
|
|
| T |
3807865 |
gctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3975550 - 3975604
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5234203 - 5234149
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 6509209 - 6509263
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| |||||||| |||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 6509469 - 6509415
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 8144657 - 8144603
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 9659688 - 9659634
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 16853588 - 16853534
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 17999466 - 17999512
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 19005599 - 19005649
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||| ||||| |||| ||| |||||||||||||||| |||||||| |
|
|
| T |
19005599 |
gctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt |
19005649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 20388275 - 20388329
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20388329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 20388674 - 20388620
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||| |||||||||||| |
|
|
| T |
20388674 |
gctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 23399613 - 23399667
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 23676451 - 23676397
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25988748 - 25988694
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26878070 - 26878016
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 28528906 - 28528960
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || | ||| |||||||||||||| ||||||||| |||| |
|
|
| T |
28528906 |
gctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 28911578 - 28911632
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| |||||||| |||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
28911632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29198304 - 29198358
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
29198304 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29198661 - 29198607
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30223462 - 30223516
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 30352563 - 30352617
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||| ||| |||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggt |
30352617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 39439028 - 39438974
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 39719641 - 39719587
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| |||||||| |||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 39833235 - 39833181
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||||||||||| |||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 44568689 - 44568635
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 46304383 - 46304329
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 46759941 - 46759887
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 48192487 - 48192433
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 3975837 - 3975788
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
3975788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 14543711 - 14543760
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
14543760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 18022703 - 18022654
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
18022654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 21223747 - 21223698
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
21223698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 21554394 - 21554443
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt |
21554443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 232
Target Start/End: Complemental strand, 22540273 - 22540236
Alignment:
| Q |
195 |
gtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
22540273 |
gtccatgtaaatatgcctcgttttggttttagttcctg |
22540236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 24717531 - 24717482
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
24717531 |
gctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt |
24717482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 229
Target Start/End: Original strand, 25547256 - 25547305
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||||||||||||| ||| || |||||| ||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc |
25547305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 26877672 - 26877733
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| |||||||||||||||| || || |||||||||||||||||||||||| |||| |
|
|
| T |
26877672 |
aaataaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 31310366 - 31310415
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
31310366 |
gctaaaatatgattttagtccctgcaaatatttctcgttttggttttagt |
31310415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 44568320 - 44568381
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| |||||||||||||||| |||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
44568320 |
aaataaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
183 |
aatatggttttagtccatgtgaatatgtctcgttttggttt |
223 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 14739003 - 14738947
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| ||||||| |||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| | || ||| |||||||||| ||||||||||||| |||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 41053833 - 41053897
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||| |||||||||||||||| |||| || |||||| ||| ||||| ||||||| |||| |
|
|
| T |
41053833 |
taaaaataaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 105)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 38930303 - 38930359
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggt |
38930359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 16789068 - 16789130
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
16789068 |
aaaataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 19494120 - 19494176
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
19494176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25131112 - 25131166
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 169 - 234
Target Start/End: Original strand, 22917556 - 22917621
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
22917556 |
aaaaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1408006 - 1408060
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctg |
1408060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 9496342 - 9496396
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
9496342 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10776498 - 10776444
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 14238752 - 14238806
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14238806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 14495070 - 14495124
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 21126020 - 21125966
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
21126020 |
gctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25600231 - 25600285
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29158355 - 29158409
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 7272421 - 7272470
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
7272470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 24187907 - 24187842
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| || ||||||||||| ||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
24187907 |
ttaaaaaaaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 1526171 - 1526115
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 8094480 - 8094536
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
8094480 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggt |
8094536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 11019511 - 11019575
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||| |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
11019511 |
taaaattaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 16644043 - 16643987
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggt |
16643987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 19494412 - 19494356
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1778565 - 1778619
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3512265 - 3512211
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4017299 - 4017245
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 7186003 - 7185949
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 7420231 - 7420285
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 8298588 - 8298642
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 8298974 - 8298920
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8298974 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 10337120 - 10337174
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 14239079 - 14239025
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 14489072 - 14489018
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 16789368 - 16789314
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16789314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 22650465 - 22650519
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 27341590 - 27341536
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 32418310 - 32418368
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || ||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
32418310 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32418368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 32725908 - 32725962
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 34963663 - 34963609
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35097329 - 35097383
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35143843 - 35143789
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
35143843 |
gctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35346630 - 35346684
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35346997 - 35346943
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40066498 - 40066552
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| ||||||||||||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40492961 - 40493015
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||||||||| |||| |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 42133153 - 42133099
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43477164 - 43477218
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 1525810 - 1525859
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1525859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 6146517 - 6146566
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6146566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 8094840 - 8094791
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
8094791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 15719657 - 15719706
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt |
15719706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 24955009 - 24954960
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt |
24954960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 232
Target Start/End: Original strand, 28346384 - 28346449
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| ||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28346384 |
ttaaaattaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4016901 - 4016953
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
4016901 |
ataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 16643662 - 16643718
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 34963295 - 34963355
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
34963295 |
aataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 43727431 - 43727384
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt |
43727384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 1685117 - 1685164
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1685164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 4375693 - 4375740
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 9175368 - 9175321
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||| |||| ||| |||||| ||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
9175321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 42132865 - 42132912
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 2728233 - 2728287
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 2728596 - 2728542
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4473705 - 4473759
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4710219 - 4710165
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 6146948 - 6146894
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
6146894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 6469281 - 6469335
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||| ||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
6469281 |
gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 7272750 - 7272696
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || || |||||| ||||||||||||||||| |||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 7326087 - 7326141
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
7326087 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 7326420 - 7326366
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 9175013 - 9175067
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11019856 - 11019802
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 11976374 - 11976428
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 227
Target Start/End: Complemental strand, 14495393 - 14495340
Alignment:
| Q |
174 |
taatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||| ||||||||||||||||| |
|
|
| T |
14495393 |
taatgctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt |
14495340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 17073808 - 17073862
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 17574462 - 17574408
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19962996 - 19963050
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
19962996 |
gctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 20984147 - 20984201
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 20984509 - 20984455
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 26530673 - 26530723
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| |||| ||||||||||||| |
|
|
| T |
26530673 |
aaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 28346757 - 28346703
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29488109 - 29488055
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
29488055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 32726270 - 32726216
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33526411 - 33526357
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35097691 - 35097637
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 37536087 - 37536141
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 40066819 - 40066765
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| | ||||||||||||||| |||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40844157 - 40844211
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 1163273 - 1163224
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||||| |||||||| |
|
|
| T |
1163273 |
gctaaaatatggttttagtccatgcaaatatgccccgttttagttttagt |
1163224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 14488717 - 14488766
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt |
14488766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 18549202 - 18549251
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
18549251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 23939548 - 23939601
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||| |||||||||||| |
|
|
| T |
23939548 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct |
23939601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 24090487 - 24090438
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
24090438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 25131446 - 25131397
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
25131397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29158668 - 29158619
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || ||||| |||||||||||||||||| |
|
|
| T |
29158668 |
gctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt |
29158619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttt |
223 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 33636323 - 33636372
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
33636372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 42430119 - 42430070
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42430070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 1162910 - 1162966
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| ||||||| |||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
1162966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 10337458 - 10337394
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| | |||||||||||||||| |||| || |||||| |||||||| |||||||| |||| |
|
|
| T |
10337458 |
taaaaattaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 229
Target Start/End: Complemental strand, 13232570 - 13232510
Alignment:
| Q |
170 |
aaaataatg-ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||||||| ||||||||||||||| |||| || |||||| ||| ||||||||||||||| |
|
|
| T |
13232570 |
aaaataatggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc |
13232510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 30969397 - 30969453
Alignment:
| Q |
176 |
atgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||| |||||||||||||||| |||| |
|
|
| T |
30969397 |
atgctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 38930663 - 38930607
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||| | |||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 131)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 41358662 - 41358606
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
41358606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 234
Target Start/End: Original strand, 31258330 - 31258396
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| ||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
31258330 |
taaaattaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
31258396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 32626530 - 32626584
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 45290458 - 45290514
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
45290514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 29072489 - 29072552
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29072489 |
aaaaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29072552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3753571 - 3753517
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 6567495 - 6567441
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 13260320 - 13260266
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 14007490 - 14007544
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14007544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 168 - 234
Target Start/End: Complemental strand, 19623026 - 19622960
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
19623026 |
taaaaataaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21391097 - 21391151
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 22953555 - 22953501
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctg |
22953501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26442898 - 26442844
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
26442844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 172 - 234
Target Start/End: Complemental strand, 32729054 - 32728992
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
32729054 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
32728992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35307716 - 35307770
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 37545629 - 37545683
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 12360974 - 12360913
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
12360974 |
aaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 15211512 - 15211561
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
15211561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 19622656 - 19622705
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19622705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 26191733 - 26191684
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26191684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 26442564 - 26442613
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26442613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 48609593 - 48609544
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48609544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 990378 - 990322
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 7001896 - 7001840
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7001840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 10887608 - 10887548
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||| | |||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
10887608 |
ttaaaaattaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10887548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 227
Target Start/End: Original strand, 16083037 - 16083097
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
16083037 |
ttaaaaataaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagt |
16083097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 18473273 - 18473329
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18473329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 26061957 - 26062013
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 39303673 - 39303729
Alignment:
| Q |
176 |
atgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||||||| |||| |
|
|
| T |
39303673 |
atgctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 41358370 - 41358426
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 41881094 - 41881150
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggt |
41881150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 171 - 227
Target Start/End: Original strand, 44641072 - 44641128
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
44641072 |
aaataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44641128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 3247190 - 3247253
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3247190 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 27521568 - 27521631
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || ||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
27521568 |
aaaaaaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 46868576 - 46868521
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctgg |
233 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 234
Target Start/End: Original strand, 990083 - 990145
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||| ||||||||||||||||| |||||| |
|
|
| T |
990083 |
aataaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggt |
990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1810928 - 1810982
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3753214 - 3753268
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3753268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 7867130 - 7867184
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 8140435 - 8140489
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 10631165 - 10631219
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11822364 - 11822310
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 12361004 - 12361066
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| ||||||||||||||||||||| || ||| || ||||||||||||||||| |||| |
|
|
| T |
12361004 |
aaaataaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctg |
12361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13770490 - 13770544
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13770544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 15526361 - 15526307
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 18302386 - 18302332
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19720713 - 19720767
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21383105 - 21383159
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
21383105 |
gctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
21383159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 22919685 - 22919739
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22919739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24977779 - 24977833
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30322930 - 30322984
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33000668 - 33000614
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 33067349 - 33067395
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33067729 - 33067675
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctg |
33067675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 34002939 - 34002885
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35056531 - 35056585
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35308110 - 35308056
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35308056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 39747834 - 39747780
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
39747834 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40718111 - 40718165
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 45368491 - 45368545
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 45380273 - 45380327
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 48609237 - 48609291
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 11822005 - 11822054
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
11822054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 18473594 - 18473545
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 22674204 - 22674253
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
22674204 |
gctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt |
22674253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 26324946 - 26324897
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
26324946 |
gctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt |
26324897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 33379889 - 33379938
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33379938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 35005743 - 35005694
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35005694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 224
Target Start/End: Original strand, 37624736 - 37624793
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| || |||||| |||||||||||||| |
|
|
| T |
37624736 |
ttaaaaataaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 37625026 - 37624977
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||| |||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagt |
37624977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 231
Target Start/End: Complemental strand, 45638893 - 45638840
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
45638893 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcct |
45638840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||| ||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 18900130 - 18900078
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
18900078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 24649351 - 24649399
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 24654166 - 24654118
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 34808200 - 34808252
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 35005435 - 35005499
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
35005435 |
taaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 45290819 - 45290763
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 7350426 - 7350473
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
7350473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 12322969 - 12322922
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 20756022 - 20756069
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagt |
20756069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 21391371 - 21391324
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||||||| |||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagt |
21391324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 181 - 232
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
| Q |
181 |
aaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 49073692 - 49073739
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 50428874 - 50428921
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3679627 - 3679681
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
3679681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 4360631 - 4360577
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
4360631 |
aataaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag |
4360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 7818783 - 7818833
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||| |||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtt |
7818833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10631527 - 10631473
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 10887234 - 10887288
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13259989 - 13260043
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg |
13260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 227
Target Start/End: Original strand, 15058418 - 15058468
Alignment:
| Q |
177 |
tgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
15058418 |
tgctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt |
15058468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 17984325 - 17984383
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || ||||||||||||||| ||||| || |||||| ||||||||||||||||| |
|
|
| T |
17984325 |
aaaaacaaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt |
17984383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 24507842 - 24507788
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24653803 - 24653857
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29072861 - 29072807
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||| |||||||||||| |||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 31060788 - 31060842
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 234
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||| |||||||| |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 32454293 - 32454239
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||| |||||| |||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctg |
32454239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33045689 - 33045635
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 38151211 - 38151157
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 38164294 - 38164240
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 44641431 - 44641377
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
44641377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 47819233 - 47819287
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 47819595 - 47819541
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 48956065 - 48956011
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
48956011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 50429208 - 50429154
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
50429154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 50799131 - 50799185
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 52254478 - 52254424
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
4323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 4324163 - 4324118
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggtttta |
4324118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 17984700 - 17984651
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
17984651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 26191360 - 26191409
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
26191409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29688427 - 29688378
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
29688378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 42482980 - 42483029
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42483029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 48955715 - 48955764
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
48955764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 52254184 - 52254233
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
52254233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 7867366 - 7867302
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || ||||||||| ||||||||||||| |||| |
|
|
| T |
7867366 |
taaaaagaaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 169 - 229
Target Start/End: Complemental strand, 15058774 - 15058714
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||| || |||||||||| ||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
15058774 |
aaaaaaaaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttc |
15058714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 22953258 - 22953306
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagt |
22953306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 232
Target Start/End: Complemental strand, 31061156 - 31061096
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| |||||||||||||||| ||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
31061156 |
aataaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 113)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 178 - 229
Target Start/End: Original strand, 38962807 - 38962858
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttc |
38962858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29366948 - 29366894
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 42207243 - 42207297
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctg |
42207297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 29172894 - 29172829
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
29172894 |
aaaaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 34125642 - 34125577
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
34125642 |
ttaaaaataaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 40029142 - 40029189
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 5614154 - 5614216
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
5614154 |
ttttaaaaaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5614529 - 5614475
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10744053 - 10743999
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
10743999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 15635379 - 15635433
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggt |
15635433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 23381951 - 23382005
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
23381951 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26133412 - 26133358
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 36577723 - 36577777
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36577777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 40168007 - 40167953
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 14318046 - 14318095
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
14318095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 29151855 - 29151794
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||| | || |||||| |||||||||||||||||||||||| |
|
|
| T |
29151855 |
ataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 234
Target Start/End: Original strand, 29172523 - 29172580
Alignment:
| Q |
177 |
tgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
29172523 |
tgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 38496786 - 38496725
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
38496786 |
ataaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 15635714 - 15635650
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||| | |||||| ||||||||||||||||| |||||| |
|
|
| T |
15635714 |
aaaataaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 18633600 - 18633656
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 29875724 - 29875668
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct |
35609583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 45139 - 45193
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1381248 - 1381302
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 2217495 - 2217549
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4203769 - 4203715
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5917127 - 5917181
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
5917127 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5950177 - 5950231
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
5950231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 7075573 - 7075627
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 234
Target Start/End: Original strand, 10408919 - 10408985
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
10408919 |
taaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
10408985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11799457 - 11799403
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 18046039 - 18046093
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19565468 - 19565522
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19685018 - 19685072
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21124914 - 21124968
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24781990 - 24782044
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 28550828 - 28550882
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28550882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 28863511 - 28863565
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 28863837 - 28863783
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29692745 - 29692799
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 234
Target Start/End: Original strand, 29875391 - 29875457
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
29875391 |
taaaaataaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggt |
29875457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30800495 - 30800549
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30800849 - 30800795
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30888161 - 30888215
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33336025 - 33335971
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
33335971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35167164 - 35167110
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35928457 - 35928403
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 36578082 - 36578028
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 40029496 - 40029442
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 2032939 - 2032890
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt |
2032890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 2217853 - 2217804
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 4203457 - 4203506
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 10743725 - 10743774
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10743774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 16038378 - 16038427
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16038427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 18046347 - 18046298
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18046298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 18258526 - 18258477
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
18258477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 20690734 - 20690783
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20690783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 22550960 - 22551005
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
22550960 |
ctaaaatatggttttagtacatgtaaatatgtctcgttttagtttt |
22551005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 6118498 - 6118442
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| | |||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggt |
6118442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 18633960 - 18633904
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| | |||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggt |
18633904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 25561706 - 25561762
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggt |
25561762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 35166157 - 35166101
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| |||||||||||||||| || || ||||||||||||||||||||| |||||| |
|
|
| T |
35166157 |
gctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggt |
35166101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 35877051 - 35877003
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 9179919 - 9179872
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 9532532 - 9532485
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
9532485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 25561998 - 25561951
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 1105147 - 1105093
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 1381610 - 1381556
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 2637001 - 2636943
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || |||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
2637001 |
aaaaaaaaagctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
2636943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3851328 - 3851274
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| ||||||| |||| |
|
|
| T |
3851328 |
gctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4736541 - 4736487
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5917459 - 5917405
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 6912498 - 6912552
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 9179594 - 9179648
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 12144908 - 12144962
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
12144908 |
gctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 19565830 - 19565776
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 19685379 - 19685325
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 22551327 - 22551269
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || |||||||||||||||||||| ||| ||||||| | |||||||||||||| |
|
|
| T |
22551327 |
aaaaaaaaagctaaaatatggttttagtctctgtaaatatgttttgttttggttttagt |
22551269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 24443743 - 24443689
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25779161 - 25779107
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 26133184 - 26133238
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 28871993 - 28871939
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| ||||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
28871993 |
gctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35609304 - 35609358
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||||||||| |||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35928065 - 35928119
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 36973709 - 36973655
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 37271705 - 37271651
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 38170515 - 38170569
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 38786160 - 38786214
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
38786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||| ||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40167787 - 40167841
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| |||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40764416 - 40764470
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 293829 - 293878
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
293878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 2636670 - 2636719
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||| ||||||||||||||||||| |
|
|
| T |
2636670 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt |
2636719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 5103649 - 5103702
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
||||||||||| |||| || ||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
5103649 |
gctaaaatatgattttggttcatgtaaatatgactcgttttggttttaattcct |
5103702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 10409325 - 10409276
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10409276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 13990894 - 13990845
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
13990845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 228
Target Start/End: Complemental strand, 18286747 - 18286690
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||| ||||||| ||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
18286747 |
aaataaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagtt |
18286690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 20660949 - 20660998
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20660998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 23382296 - 23382247
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
23382247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 34125308 - 34125357
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
34125357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 39379609 - 39379560
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
39379560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 42553643 - 42553692
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42553692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 42994069 - 42994122
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcct |
231 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||| ||||| |
|
|
| T |
42994069 |
gctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct |
42994122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 16038738 - 16038690
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
16038690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 17070862 - 17070814
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 27850372 - 27850324
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagt |
27850324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 29151517 - 29151573
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
29151517 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggt |
29151573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 35166912 - 35166960
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
||||||||||||||||||||| || |||||| || ||||||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 114)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 173 - 232
Target Start/End: Complemental strand, 36815839 - 36815780
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36815839 |
ataaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 9195055 - 9195109
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 10374773 - 10374829
Alignment:
| Q |
176 |
atgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
10374773 |
atgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 19183783 - 19183839
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
19183839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 26813867 - 26813923
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 7814236 - 7814303
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||| || |||||||||| |||||||||| ||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
7814236 |
ttaaaaacaaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5790898 - 5790844
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 11713486 - 11713540
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11788415 - 11788361
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 182 - 228
Target Start/End: Original strand, 11943543 - 11943589
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagtt |
11943589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 36622251 - 36622305
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 172 - 234
Target Start/End: Complemental strand, 37272107 - 37272045
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
37272107 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37272045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 10671940 - 10671891
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
10671891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 16900210 - 16900149
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
16900210 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 16993601 - 16993540
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
16993601 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 27311068 - 27311019
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt |
27311019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 38639413 - 38639462
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
38639462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 19184150 - 19184094
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 20939334 - 20939270
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||| |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
20939334 |
taaaattaacgctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 26814228 - 26814172
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 33576126 - 33576062
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
33576126 |
taaaaagaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 37271740 - 37271796
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 38980252 - 38980196
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
38980196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 43597508 - 43597444
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
43597508 |
taaaattaaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
43597444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 232
Target Start/End: Complemental strand, 2265405 - 2265342
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
2265405 |
aaaattaaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 10375068 - 10375021
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 23990193 - 23990146
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
23990146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3671004 - 3671058
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| ||||||| |||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4424184 - 4424130
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13215061 - 13215115
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13215061 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 20131318 - 20131372
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 24483890 - 24483836
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25705086 - 25705140
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26239159 - 26239105
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 33732863 - 33732917
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33732917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 40302338 - 40302284
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 41451838 - 41451892
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 41693675 - 41693729
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43592047 - 43592101
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43671935 - 43671989
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
43671935 |
gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 44559063 - 44559117
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
44559063 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 44985983 - 44985929
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 45442700 - 45442646
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||| ||||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45442700 |
ataaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagt |
45442646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 11713855 - 11713790
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| || ||||||||| ||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
11713855 |
ttaaaaaaaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
11713790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 17541775 - 17541726
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
17541726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 22881614 - 22881663
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22881663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 31644842 - 31644891
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
31644891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 42695869 - 42695918
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42695918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 43788859 - 43788908
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43788908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 44985623 - 44985676
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44985676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 5790559 - 5790615
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||| ||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 14003751 - 14003687
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
14003751 |
taaaaacaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 16522986 - 16523046
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
16522986 |
aataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 17541383 - 17541439
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 20131690 - 20131626
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
20131690 |
taaaaatatggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 26238816 - 26238868
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26238868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
| Q |
183 |
aatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
35155342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 38731824 - 38731884
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| |||||||||| |||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38731824 |
aataaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38731884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 44073806 - 44073750
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
44073750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 227
Target Start/End: Original strand, 1295190 - 1295233
Alignment:
| Q |
184 |
atatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
1295190 |
atatgattttggtccatgtaaatatgtctcgttttggttttagt |
1295233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 17912452 - 17912499
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
17912499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 33733240 - 33733193
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 181 - 232
Target Start/End: Complemental strand, 36806892 - 36806841
Alignment:
| Q |
181 |
aaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 146689 - 146635
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 1497611 - 1497665
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 2481194 - 2481248
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||||||||| |||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 2481556 - 2481502
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 3671187 - 3671137
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3837934 - 3837988
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3838263 - 3838209
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
3838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4423896 - 4423950
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4794131 - 4794185
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5334752 - 5334806
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5335039 - 5334985
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 8046330 - 8046384
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 8046647 - 8046593
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 9195205 - 9195151
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || || |||||| ||||||||||||||||| |||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 10664985 - 10665039
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| | ||||| |||| |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctg |
10665039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 10671631 - 10671685
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 15842822 - 15842768
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 16523324 - 16523270
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 16673412 - 16673466
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 17302142 - 17302088
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||||||||| |||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24358617 - 24358671
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24483401 - 24483455
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||| |||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg |
24483455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25705448 - 25705394
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29859871 - 29859817
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 29865510 - 29865456
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctg |
29865456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 31225716 - 31225770
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||| || |||||| ||||||||| |||||||||||| |
|
|
| T |
31225716 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 33575753 - 33575807
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 37228725 - 37228783
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || |||||||||||||||| |||| || ||||||| |||||||||||||||| |
|
|
| T |
37228725 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt |
37228783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40124967 - 40125021
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||| |||||||||||||||||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40786461 - 40786515
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||||||||| |||| |
|
|
| T |
40786461 |
gctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 41694002 - 41693948
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43597155 - 43597209
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||||||||||| |||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 4042889 - 4042840
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
4042889 |
gctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt |
4042840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 23989839 - 23989888
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
23989888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 25954116 - 25954165
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
25954116 |
gctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagt |
25954165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 27310877 - 27310922
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttt |
223 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 228
Target Start/End: Complemental strand, 36622582 - 36622533
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtt |
36622533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 38979890 - 38979947
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatat-gtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||||||||||||| |||||| |
|
|
| T |
38979890 |
gctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 44994060 - 44994011
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||||||||| |||||||| |
|
|
| T |
44994060 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt |
44994011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 34964158 - 34964110
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||| ||||||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 43789191 - 43789135
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| | || |||||| |||||||||||||||| |||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggt |
43789135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 122)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30130159 - 30130213
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 51834596 - 51834665
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
51834596 |
ttttaaaactaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 26799889 - 26799945
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
26799945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 39436719 - 39436775
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 4814533 - 4814588
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
4814533 |
aaaataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 474407 - 474353
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
474407 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 16123140 - 16123194
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 21159441 - 21159503
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
21159441 |
ttttaaaaaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 21159816 - 21159762
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 22008527 - 22008581
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 22016045 - 22016099
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 168 - 234
Target Start/End: Complemental strand, 22156302 - 22156236
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||| | ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
22156302 |
taaaaattaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30552477 - 30552423
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43441271 - 43441325
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 53701662 - 53701608
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 34238599 - 34238648
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34238648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 39288574 - 39288623
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
39288623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 3152110 - 3152054
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
3152054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 10976979 - 10977035
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
10977035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 12741280 - 12741216
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
12741280 |
taaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 20612897 - 20612841
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 22155930 - 22155986
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
22155986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 28427246 - 28427302
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||||||||||||||| |||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 28427607 - 28427551
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
28427551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 37506868 - 37506924
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 39437108 - 39437052
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39437052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 40169653 - 40169597
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
40169597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 232
Target Start/End: Original strand, 474040 - 474099
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
474040 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 232
Target Start/End: Complemental strand, 48924244 - 48924185
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||||||||||||||| |||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
48924244 |
ataaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4034718 - 4034772
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4513264 - 4513318
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4513619 - 4513565
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctg |
4513565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4950038 - 4950092
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 7518444 - 7518394
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttc |
229 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttc |
7518394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 12673645 - 12673699
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||||||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 12740908 - 12740962
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25710869 - 25710815
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
25710815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26090077 - 26090023
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 29955661 - 29955611
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 30004816 - 30004766
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30128285 - 30128339
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || || |||||||||||||||||||||||||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 31869955 - 31869901
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
31869901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 37507221 - 37507167
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 44802283 - 44802337
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 45002022 - 45002076
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 47336580 - 47336526
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
47336580 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 51550445 - 51550391
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 54608862 - 54608808
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
54608862 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 3151751 - 3151800
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3151800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 3830515 - 3830466
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3830466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 4814897 - 4814849
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt |
4814849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 19656542 - 19656591
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
19656591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 20611013 - 20611070
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
20611013 |
aaaataaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
20611070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 28942909 - 28942848
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||| | || |||||| ||||||||||||||||| |||||| |
|
|
| T |
28942909 |
ataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29446205 - 29446156
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
29446205 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
29446156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29490742 - 29490693
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
29490742 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29490693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 29525106 - 29525155
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt |
29525155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 169 - 234
Target Start/End: Original strand, 40169336 - 40169401
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||| || ||||||||||||||||| ||| || |||||||||||||||| ||||||| |||||| |
|
|
| T |
40169336 |
aaaaaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 43440496 - 43440545
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt |
43440545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 45320989 - 45320924
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
45320989 |
ttaaaattaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
45320924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 46186770 - 46186721
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
46186721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 275832 - 275780
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcc |
230 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
275832 |
gctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc |
275780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 8510215 - 8510271
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggt |
8510271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 13584366 - 13584310
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 14633888 - 14633832
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||| |||||||||||||| |||||| |
|
|
| T |
14633888 |
gctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
14633832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 39288897 - 39288841
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 47005145 - 47005209
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
47005145 |
taaaaagaaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 51834941 - 51834885
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
51834885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
183 |
aatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 226
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 31480128 - 31480191
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
31480128 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 45161116 - 45161163
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagt |
45161163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3830135 - 3830189
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
3830189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 4035052 - 4034998
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| |||||||| ||||||||||||| |
|
|
| T |
4035052 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5345688 - 5345634
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
5345634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 9863403 - 9863349
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
9863349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 15016389 - 15016443
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 15979700 - 15979646
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 22008889 - 22008835
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25615976 - 25616030
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 25710515 - 25710565
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 28552382 - 28552328
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 28942526 - 28942576
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
||||||||||||||||||||| || |||||| || ||||||||||||||| |
|
|
| T |
28942526 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt |
28942576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29445955 - 29446009
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29446009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29686545 - 29686599
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||| |||| ||| |||||| ||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30034471 - 30034417
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30268506 - 30268560
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 35177256 - 35177306
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
35177256 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtt |
35177306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 40370286 - 40370340
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
40370286 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 46622128 - 46622074
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 46901105 - 46901155
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
46901105 |
gctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtt |
46901155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 49323783 - 49323837
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 51500684 - 51500630
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 51550083 - 51550137
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 51759820 - 51759874
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| | || |||||||||||||||||||||||| |||| |
|
|
| T |
51759820 |
gctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 54608519 - 54608573
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 863282 - 863331
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
863282 |
gctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagt |
863331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 1721462 - 1721397
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||| || |||||||||||||||| |||| || |||||| |||||||||||||||| |||| |
|
|
| T |
1721462 |
ttaaaaagaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 3361817 - 3361768
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
3361768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 9262154 - 9262105
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
9262105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 28452148 - 28452197
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||| |||||||||||||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagt |
28452197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 29955300 - 29955353
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
29955353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 30004454 - 30004507
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30004507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 30424629 - 30424678
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||| |||||||| |
|
|
| T |
30424629 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt |
30424678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| | | || |||||||||||||||||||||||| |||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 40370588 - 40370539
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
40370539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 46751272 - 46751321
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
46751321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 47114488 - 47114537
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |
|
|
| T |
47114488 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
47114537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 51500399 - 51500448
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
51500399 |
gctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt |
51500448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 10977340 - 10977284
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||| |||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
10977340 |
gctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 16679678 - 16679726
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagt |
16679726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 19297947 - 19297899
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||| |||| ||| |||||||||||||||| ||||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagt |
19297899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 46186407 - 46186459
Alignment:
| Q |
175 |
aatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
46186407 |
aatgctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
46186459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||||||| |||||| || |||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 293 - 232
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
293 |
ataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 136)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 9289267 - 9289323
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 50714564 - 50714508
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
50714508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 46088059 - 46088004
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctgg |
233 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 13479610 - 13479556
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 32365095 - 32365149
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 45505893 - 45505839
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 45593585 - 45593531
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 52442091 - 52442037
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 53916046 - 53915992
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
53916046 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 6827539 - 6827596
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
6827539 |
aaaataaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6827596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||||||||||||| |||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 22099911 - 22099862
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
22099862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 22584288 - 22584337
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
22584337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 24474962 - 24474913
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
24474913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29380909 - 29380860
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29380860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 34361804 - 34361853
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34361853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 41620260 - 41620199
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||||| |||||||||||||||| |||||| |
|
|
| T |
41620260 |
ataaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
41620199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 9289634 - 9289582
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 171 - 227
Target Start/End: Complemental strand, 13764813 - 13764757
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||| ||||||| |||||||||||||||| |
|
|
| T |
13764813 |
aaataaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt |
13764757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 23778965 - 23779021
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||||| |||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggt |
23779021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 35415300 - 35415356
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| |||||||||||||||| |||||| |
|
|
| T |
35415300 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
35415356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 35415632 - 35415576
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 35763648 - 35763704
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 41345854 - 41345910
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 172 - 232
Target Start/End: Complemental strand, 52017875 - 52017815
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
52017875 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 232
Target Start/End: Original strand, 52017501 - 52017560
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
52017501 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 8760780 - 8760726
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 9446322 - 9446276
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9446322 |
gctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 11285496 - 11285558
Alignment:
| Q |
170 |
aaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
11285496 |
aaaaaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 13064464 - 13064410
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13073760 - 13073814
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13631229 - 13631283
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 14791805 - 14791751
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 227
Target Start/End: Complemental strand, 15555642 - 15555588
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||| |||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
15555642 |
ataaagctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
15555588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 16712690 - 16712636
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16712636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25358539 - 25358485
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 25423925 - 25423979
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25424311 - 25424257
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 28809012 - 28809066
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 32365482 - 32365428
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 35464019 - 35464073
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 36702001 - 36702055
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 43231089 - 43231143
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 46115778 - 46115724
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 46128912 - 46128858
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
182 |
aaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 52430099 - 52430045
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 52441764 - 52441818
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
52441818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 53717173 - 53717119
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 18205157 - 18205206
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18205206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 22099544 - 22099593
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22099593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 29420536 - 29420487
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
29420536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29420487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 32208543 - 32208592
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32208592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 41346217 - 41346168
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
41346168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 43368467 - 43368520
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
43368520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 51708694 - 51708743
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
51708743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 53716922 - 53716971
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
53716922 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
53716971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 166 - 227
Target Start/End: Complemental strand, 54208836 - 54208775
Alignment:
| Q |
166 |
tttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||| || | |||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
54208836 |
tttaaaaagaaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
54208775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 123535 - 123591
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 6827873 - 6827817
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 13631608 - 13631544
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| |||| |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13631608 |
taaacataaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 19903653 - 19903605
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19903605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 232
Target Start/End: Original strand, 24774036 - 24774100
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || |||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
24774036 |
taaaaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 27008075 - 27008139
Alignment:
| Q |
169 |
aaaaataatg-ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
27008075 |
aaaaataatggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 38054549 - 38054601
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38054601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 227
Target Start/End: Original strand, 47022734 - 47022790
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||| | |||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
47022734 |
aaataaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47022790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 50714241 - 50714297
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 51545966 - 51545914
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51545914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Complemental strand, 2322440 - 2322377
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || |||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
2322440 |
aaaaaaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 9445941 - 9446004
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
9445941 |
aaaaataagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 232
Target Start/End: Complemental strand, 26314340 - 26314277
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| || |||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
26314340 |
aaaaaaaaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 233
Target Start/End: Original strand, 29380669 - 29380724
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctgg |
233 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||||||||||||| || ||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 52543423 - 52543470
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 232
Target Start/End: Original strand, 55072377 - 55072444
Alignment:
| Q |
165 |
ttttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||| || ||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
55072377 |
ttttataaagaaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 2034854 - 2034800
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 2180221 - 2180275
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4279023 - 4279077
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||| || || ||||| |||||||||||||||||| |||| |
|
|
| T |
4279023 |
gctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 227
Target Start/End: Complemental strand, 4279343 - 4279285
Alignment:
| Q |
170 |
aaaataatg-ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| |||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
4279343 |
aaaataatggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt |
4279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5827656 - 5827710
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 5827972 - 5827918
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 5882553 - 5882606
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 8760605 - 8760659
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||| |||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11693120 - 11693066
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 12152492 - 12152446
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
12152492 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13064160 - 13064214
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
13064214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 13530712 - 13530658
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 13764614 - 13764668
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||| ||| |||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 14488186 - 14488132
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 19321858 - 19321804
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 23245232 - 23245286
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 23245594 - 23245540
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
23245594 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 23779224 - 23779170
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 26412191 - 26412245
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
26412191 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 26412583 - 26412529
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 28809188 - 28809130
Alignment:
| Q |
169 |
aaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| || ||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
28809188 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
28809130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 29463912 - 29463866
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 29499183 - 29499237
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30046791 - 30046737
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30061132 - 30061078
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 31370805 - 31370855
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
31370805 |
gctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt |
31370855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 31560694 - 31560640
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 31812212 - 31812158
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||||||||| |||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 34355282 - 34355228
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
34355282 |
gctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 35464381 - 35464327
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 42823777 - 42823831
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| |||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 42848028 - 42848082
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||||||||| |||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 42848390 - 42848336
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 43231388 - 43231334
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 45505601 - 45505655
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 46115415 - 46115469
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 46128549 - 46128603
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 227
Target Start/End: Original strand, 51545625 - 51545679
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
51545625 |
ataaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
51545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 53308067 - 53308013
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||| ||||||||||||||| |||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 5052583 - 5052534
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||| |||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5052534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 225
Target Start/End: Complemental strand, 20144740 - 20144683
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||| |||| |||||||||||||||| || |||| |||||| ||||||||||||||| |
|
|
| T |
20144740 |
taaatataaggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 28448835 - 28448884
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt |
28448884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 29499552 - 29499491
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| | |||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
29499552 |
aaataaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || ||||||| | |||||||||||||| |||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 41921083 - 41921034
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||| || || ||||||| |||||||||||||||| |
|
|
| T |
41921083 |
gctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagt |
41921034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 44925486 - 44925535
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
44925486 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
44925535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 46292650 - 46292601
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
46292601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 47136170 - 47136121
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
47136121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 47274229 - 47274180
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||| | || |||||||||||||||||||||||| |
|
|
| T |
47274229 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 51709026 - 51708977
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||| ||||||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
51708977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 175 - 232
Target Start/End: Complemental strand, 51763204 - 51763147
Alignment:
| Q |
175 |
aatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||| ||||| |||| || |||||| ||| |||||||||||||||||| |
|
|
| T |
51763204 |
aatgctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 54903481 - 54903420
Alignment:
| Q |
171 |
aaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| |||||||||||||||| |||| || |||||| | ||||||||||||||| |||| |
|
|
| T |
54903481 |
aaataaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 35763954 - 35763898
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
35763954 |
gctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggt |
35763898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||| ||||||||||||||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| ||| |||||| || ||||||||||||| |||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 1312 - 1368
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 1643 - 1587
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| |||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
1643 |
gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 93)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 14656269 - 14656205
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||| |||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
14656269 |
taaaaataaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 168 - 227
Target Start/End: Original strand, 12757601 - 12757660
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| |||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
12757601 |
taaaaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12757660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 232
Target Start/End: Original strand, 23770161 - 23770216
Alignment:
| Q |
177 |
tgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
23770161 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 167 - 225
Target Start/End: Complemental strand, 494762 - 494704
Alignment:
| Q |
167 |
ttaaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||| || ||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
494762 |
ttaaaaaaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3414751 - 3414697
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 12176377 - 12176435
Alignment:
| Q |
170 |
aaaataatg-ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
12176377 |
aaaataatggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagt |
12176435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25431853 - 25431799
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 30928682 - 30928736
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 168 - 234
Target Start/End: Original strand, 31166861 - 31166927
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
31166861 |
taaaaaaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
31166927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 7156159 - 7156103
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 15076203 - 15076147
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15076147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 24274130 - 24274074
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 33801742 - 33801686
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
33801686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 33808621 - 33808677
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 3276359 - 3276304
Alignment:
| Q |
172 |
aataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||| |||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
3276359 |
aataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3276304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 6591440 - 6591385
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||||| ||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggt |
6591385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 23502539 - 23502492
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 1890062 - 1890116
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
1890116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3968646 - 3968700
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 6412219 - 6412273
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
6412219 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10910963 - 10910909
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 12299139 - 12299085
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 14428651 - 14428705
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
14428705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 15962028 - 15962082
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 15962388 - 15962334
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 17765010 - 17765060
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
17765060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19690394 - 19690448
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 20467717 - 20467663
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21385252 - 21385306
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 22543717 - 22543663
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24273829 - 24273883
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 24692978 - 24692924
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
24692978 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 34582530 - 34582584
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
34582584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 494406 - 494455
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
494455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
181 |
aaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 8170150 - 8170101
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8170101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 9896636 - 9896587
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
9896587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 11448538 - 11448587
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
11448587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 24901240 - 24901289
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24901289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 317813 - 317861
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttag |
226 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||||||||||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 1890451 - 1890395
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 7155798 - 7155854
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||| |||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7155854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 8680776 - 8680832
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8680832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 8681115 - 8681059
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 10091039 - 10091091
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
10091091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 12419937 - 12419881
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 14655380 - 14655436
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 22822650 - 22822594
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 31167199 - 31167143
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| ||||||| |||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 32885674 - 32885730
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
32885730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3356448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||| ||||||||||||| |||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 19296406 - 19296359
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 173 - 232
Target Start/End: Original strand, 25431572 - 25431631
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||||||||||| ||||| ||| ||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25431572 |
ataaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctg |
25431631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 26375694 - 26375741
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 318096 - 318042
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
318096 |
gctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 1007508 - 1007454
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 3414388 - 3414442
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3969008 - 3968954
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 11449168 - 11449114
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||| |||| |||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 15722611 - 15722665
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||||| ||||||| |||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 18024374 - 18024320
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 19267566 - 19267620
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| |||||||||||||||| |||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 228
Target Start/End: Complemental strand, 19321130 - 19321080
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagtt |
228 |
Q |
| |
|
|||||||||||||||| |||| || |||||| |||||||||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtt |
19321080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21993788 - 21993842
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 21994402 - 21994348
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 21995065 - 21995119
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 21995424 - 21995370
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||| |||||| |||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 22543355 - 22543409
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 25137356 - 25137302
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| || |||| |||||| ||||||||||||||||| |||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 30929043 - 30928989
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30928989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 31198616 - 31198670
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 33131849 - 33131795
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 34582891 - 34582837
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 2615873 - 2615922
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
2615922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 3356143 - 3356192
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
3356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 12419709 - 12419758
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
12419709 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
12419758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 17771912 - 17771961
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
17771961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 22792898 - 22792849
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||| |||||| || |||||| ||||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt |
22792849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 30239294 - 30239343
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||| | || |||||||||||||||||||||||| |
|
|
| T |
30239294 |
gctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagt |
30239343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 31398540 - 31398491
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
31398491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 778041 - 777985
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||| ||| || |||||| |||||||| ||||||||| ||||| |
|
|
| T |
778041 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggt |
777985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 6412588 - 6412524
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||| ||| |||||||||||||||| |||| || |||||| ||||||||| ||||||| |||| |
|
|
| T |
6412588 |
taaaattaaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 7324189 - 7324137
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 13150759 - 13150695
Alignment:
| Q |
168 |
taaaaataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||| || ||||||||||||| ||| || || |||||||||||||||||||||||| |||| |
|
|
| T |
13150759 |
taaaaaaaaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 14428948 - 14428900
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt |
14428900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 19320759 - 19320815
Alignment:
| Q |
170 |
aaaataatg-ctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||| ||||||||||||||| |||| || |||||||||| ||||||||||| |
|
|
| T |
19320759 |
aaaataatgactaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 30479064 - 30479108
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtt |
222 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||| |||||||||| |
|
|
| T |
30479064 |
gctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 10514 - 10460
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
10514 |
gctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 10169 - 10218
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
10218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 12526 - 12575
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
12575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 4042 - 4091
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
4091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 19224 - 19273
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 4287 - 4238
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
4238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 19469 - 19420
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
19420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 3533 - 3582
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
3582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3917 - 3863
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 5707 - 5651
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||| |||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
5651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 5400 - 5449
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||| || |||||||||||||| |
|
|
| T |
5400 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
5449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 173 - 232
Target Start/End: Original strand, 2774 - 2833
Alignment:
| Q |
173 |
ataatgctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
2774 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 9027 - 8973
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
179 |
ctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 14698 - 14752
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 15011 - 14957
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 3290 - 3236
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
3236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 24373 - 24427
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 27363 - 27309
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 18042 - 17988
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||| |||||| |||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 54816 - 54870
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
180 |
taaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 47926 - 47980
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 366272 - 366218
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
366218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 365980 - 366034
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||| ||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 148281 - 148227
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 8331 - 8380
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 8641 - 8592
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 8548 - 8604
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 34932 - 34988
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctggt |
234 |
Q |
| |
|
||||||||||||| ||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 5210 - 5257
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 5230 - 5277
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 82342 - 82396
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 82705 - 82651
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 75360 - 75414
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 75763 - 75709
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
|||||||||||||||| |||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 12183 - 12237
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagttcctg |
232 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| |||||||| |||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
12237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 12535 - 12486
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
12486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 94332 - 94282
Alignment:
| Q |
175 |
aatgctaaaatatggttttagtccatgtgaatatgtctcgttttggtttta |
225 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
94332 |
aatgctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Complemental strand, 4311 - 4266
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttt |
223 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 3454 - 3405
Alignment:
| Q |
178 |
gctaaaatatggttttagtccatgtgaatatgtctcgttttggttttagt |
227 |
Q |
| |
|
|||||||||| |||||||| | || |||||||||||||||||||||||| |
|
|
| T |
3454 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 224
Target Start/End: Complemental strand, 17088 - 17048
Alignment:
| Q |
184 |
atatggttttagtccatgtgaatatgtctcgttttggtttt |
224 |
Q |
| |
|
||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
17088 |
atatgattttggtccatgtaaatatgtctcgttttggtttt |
17048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University