View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19901_high_6 (Length: 258)

Name: NF19901_high_6
Description: NF19901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19901_high_6
NF19901_high_6
[»] chr2 (2 HSPs)
chr2 (19-258)||(4487706-4487945)
chr2 (130-258)||(4482727-4482855)
[»] chr4 (1 HSPs)
chr4 (175-252)||(34606351-34606428)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 4487945 - 4487706
Alignment:
19 atgatgtgttcaatcacagaggagctctcaaataagtttataattagcaattcggaatatttaacaacattcgctaaatgcaactttttgagaataaata 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| | | |||||||||||||||||||||||||||    
4487945 atgatgtgttcaatcacagaggagctctcaaataagtttataattagcaatttggaatatttaataacttgcactaaatgcaactttttgagaataaata 4487846  T
119 tgtttttgctatattgatttggaattgttgtttatatgtggctaaacaatgatggaagacttatgatgctgttgttggggacatgaccataatagaggaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4487845 tgtttttgctatattgatttggaattgttgtttatatgtggctaaacaatgatggaagacttatgatgctgttgttggggacatgaccataatagaggaa 4487746  T
219 agattgccgtatgtggattttacagtgccatatgtagaat 258  Q
    || ||||||||||||||||||||||||||||||| |||||    
4487745 aggttgccgtatgtggattttacagtgccatatgcagaat 4487706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 130 - 258
Target Start/End: Complemental strand, 4482855 - 4482727
Alignment:
130 tattgatttggaattgttgtttatatgtggctaaacaatgatggaagacttatgatgctgttgttggggacatgaccataatagaggaaagattgccgta 229  Q
    |||||||| ||| || |||||||| | ||| ||||||||||||||||||||| || ||| |||||||||||| | ||||||||||||||||||||  |||    
4482855 tattgattgggactttttgtttatgtttggttaaacaatgatggaagacttacgacgcttttgttggggacacggccataatagaggaaagattgaggta 4482756  T
230 tgtggattttacagtgccatatgtagaat 258  Q
    ||||||||||||| ||||||||| |||||    
4482755 tgtggattttacattgccatatgcagaat 4482727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 34606351 - 34606428
Alignment:
175 agacttatgatgctgttgttggggacatgaccataatagaggaaagattgccgtatgtggattttacagtgccatatg 252  Q
    |||||||||| | ||||||||| |||||||||||| | |  || |||||||  ||||| |||||||| ||||||||||    
34606351 agacttatgacggtgttgttggcgacatgaccatactggcagagagattgcaatatgtagattttactgtgccatatg 34606428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University