View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19901_high_9 (Length: 214)
Name: NF19901_high_9
Description: NF19901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19901_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 112 - 197
Target Start/End: Complemental strand, 30626522 - 30626437
Alignment:
| Q |
112 |
gacatatgcaactattcgagcaaacagcacacttaaattgttagggggacgaaaaatgttactagggtcgaataactaatcaatat |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30626522 |
gacacatgcaactattcgagcaaacagcacacttaaattgttagggggacgaaaaatgttactagggtcgaataactaatcaatat |
30626437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 30626621 - 30626582
Alignment:
| Q |
13 |
caaaggaaaatagcagatactgagaaaccatgcatgtcag |
52 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
30626621 |
caaaggaaaatagtagatactgagaagccatgcatgtcag |
30626582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University