View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19901_low_10 (Length: 214)

Name: NF19901_low_10
Description: NF19901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19901_low_10
NF19901_low_10
[»] chr7 (2 HSPs)
chr7 (112-197)||(30626437-30626522)
chr7 (13-52)||(30626582-30626621)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 112 - 197
Target Start/End: Complemental strand, 30626522 - 30626437
Alignment:
112 gacatatgcaactattcgagcaaacagcacacttaaattgttagggggacgaaaaatgttactagggtcgaataactaatcaatat 197  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30626522 gacacatgcaactattcgagcaaacagcacacttaaattgttagggggacgaaaaatgttactagggtcgaataactaatcaatat 30626437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 30626621 - 30626582
Alignment:
13 caaaggaaaatagcagatactgagaaaccatgcatgtcag 52  Q
    ||||||||||||| |||||||||||| |||||||||||||    
30626621 caaaggaaaatagtagatactgagaagccatgcatgtcag 30626582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University