View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19903_high_13 (Length: 243)
Name: NF19903_high_13
Description: NF19903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19903_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 2 - 231
Target Start/End: Complemental strand, 12812718 - 12812489
Alignment:
| Q |
2 |
ttatatacaacatctgcactcctcaatccaatccaacgagtcatattttataaaacacaaaaccgtgaggttaacataagacctacaatgggcaacacct |
101 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12812718 |
ttatatacaacatctgcagtcctcaattcaatccaacgaatcatattttataaaacacaaaaccttgaggctaacataagacctacaatgggcaacacct |
12812619 |
T |
|
| Q |
102 |
tgacaagggagtgttgtggacttggggttggaacaataatcatgtacgtatttgataatcaaaataactattcagttgcagaaccatatgctccatcata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812618 |
tgacaagggagtgttgtggacttggggttggaacaataatcatgtacgtatttgataatcaaaataactattcagttgcagaaccatatgctccatcata |
12812519 |
T |
|
| Q |
202 |
cttgcgtctacgatttggggaattggatga |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12812518 |
cttgcgtctacgatttggggaattggatga |
12812489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University