View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19903_low_10 (Length: 349)
Name: NF19903_low_10
Description: NF19903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19903_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 333
Target Start/End: Complemental strand, 15889300 - 15888978
Alignment:
| Q |
11 |
agaatgtagcaaaagttttggatgaagtaaggcctggtttgatggctgatggagggaatgtggcattacatgagatagatggtctcgttgttatcctcaa |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15889300 |
agaatgtagaaaaagttttggatgaagtaaggcctggtttgatggctgatggagggaatgtggcattgcatgagatagatggtctcgttgttatcctcaa |
15889201 |
T |
 |
| Q |
111 |
actacaaggagcgtgtggatcatgtcctagctcaaccatgacattaaagatggggatcgaaactcgtcttcgcgataagattccagaaatcttggaggtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15889200 |
actacaaggagcgtgtggatcatgtcctagctcaaccatgacattaaagatggggattgaaactcgccttcgcgataagattccagaaatcttggaggtt |
15889101 |
T |
 |
| Q |
211 |
gaacagatactagatactgagactggtcttgagctaaccgaagataatgtcgaaagtgtatgtaattcgaaccttatgcatcatttcttgcattgcgata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15889100 |
gaacagatactagatactgagactggtcttgagctaaccgaagataatgttgaaagtgtatgtaattcgaaccttatgcatcatttcttgcattgcgata |
15889001 |
T |
 |
| Q |
311 |
atttcatttgtatatcacttcct |
333 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15889000 |
atttcatttgtatatcacttcct |
15888978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University