View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_38 (Length: 356)
Name: NF19906_high_38
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 14 - 343
Target Start/End: Complemental strand, 49328682 - 49328358
Alignment:
| Q |
14 |
tttttctcatttgctattatctctatatgacccaatagtgataaattcaaaatcaggaaggtgttatgttgcttcaatatgtggactagctttatttact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49328682 |
tttttctcatttgctattatctctatatgacccaatagtgataaattcaaaatcaggaaggtgttatgttgcttcaatatgtggactagctttatttact |
49328583 |
T |
 |
| Q |
114 |
atcacaccaaaggttcacattccgctgggaagtgataatattttcaaggctatgatcatgagaatgcccaacaatcacaaatttacgtactattatatta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49328582 |
atcacaccaaaggttcacattccgctgggaagtgataatattttcaaggctatgatcatgagaatgcccaacaatcacaaatttacgtact-----atta |
49328488 |
T |
 |
| Q |
214 |
gattgttttgttcctcccatgaaaggggcagctttggcttatgtgcatgtgaacnnnnnnnnnnnnnnnnttattccacttaatttcacttgttgaatat |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49328487 |
gattgttttgttcctctcatgaaaggggcagctttggcttatgtgcatgtgaacaaaaaaggtgaaaaaattattccacttaatttcacttgttgaatat |
49328388 |
T |
 |
| Q |
314 |
acaaaattaatagatgcaaatagtagagta |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49328387 |
acaaaattaatagatgcaaatagtagagta |
49328358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University