View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_43 (Length: 328)
Name: NF19906_high_43
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 43 - 198
Target Start/End: Complemental strand, 13201259 - 13201130
Alignment:
| Q |
43 |
aaatagtctaacccctcaatttgattgtatcccttagccaccaagaggacaagtgtttggttttgctcggtttccaaatgtgcgagatgtggaaaaactc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13201259 |
aaatagtctaacccctcaatttgattgtatcccttagccaccaagag---------------------ggtttccaaatgtgcgagatgtggaaaaactc |
13201181 |
T |
|
| Q |
143 |
aacaaagctctaaataaaataatgtttatgttggtgattatagattgtctgtgaat |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13201180 |
aacaaagctct-----aaataatgtttatgttggtgattatagattgtctgtgaat |
13201130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 3004546 - 3004471
Alignment:
| Q |
6 |
tgacagttgtttgcttggcaacatgtgagaaattatcaaa-tagtctaacccctcaatttgattgtatcccttagc |
80 |
Q |
| |
|
|||||||||| |||| || ||| ||||| | ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
3004546 |
tgacagttgtaagctttgctacaggtgagtatgtatcaaagtagtctaaaccctcaatttgattgtatcccttagc |
3004471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 12995034 - 12994991
Alignment:
| Q |
43 |
aaatagtctaacccctcaatttgattgtatcccttagccaccaa |
86 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
12995034 |
aaatagtctaatccctctatttgattgtatcccttagcaaccaa |
12994991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 6 - 80
Target Start/End: Original strand, 37737876 - 37737951
Alignment:
| Q |
6 |
tgacagttgtttgcttggcaacatgtgagaaattatcaaa-tagtctaacccctcaatttgattgtatcccttagc |
80 |
Q |
| |
|
|||||||||| |||| || ||| ||||| | ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
37737876 |
tgacagttgtaagctttgctacaggtgagtatgtatcaaagtagtctaaaccctcaatttgattgtatcccttagc |
37737951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 46 - 80
Target Start/End: Original strand, 36731776 - 36731810
Alignment:
| Q |
46 |
tagtctaacccctcaatttgattgtatcccttagc |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
36731776 |
tagtctaaaccctcaatttgattgtatcccttagc |
36731810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University