View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_66 (Length: 250)
Name: NF19906_high_66
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 3558876 - 3559000
Alignment:
| Q |
1 |
cttatatatgatccttttaatagcctattgaggttgaattgaaatttttagaggtaattaaatgaataaatggagtcannnnnnnngggtcaaaatcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3558876 |
cttatatatgatccttttaatagcctattgaggttgaattgaaatttttagaggtaattaaatgaataaatggagtcattttttttgggtcaaaatcata |
3558975 |
T |
 |
| Q |
101 |
gtaacattattttatactctacctg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3558976 |
gtaacattattttatactctacctg |
3559000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 148 - 237
Target Start/End: Original strand, 3559024 - 3559113
Alignment:
| Q |
148 |
gaagggagagggtacagataagtgatccacctactactttcaattcccaaagattccatcattgttagttcaaacacaaatgtcatgcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3559024 |
gaagggagagggtacagataagtgatccacctactactttcaattcccaaagattccatcattgttagttcaaacacaaatgtcatgcct |
3559113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University