View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_67 (Length: 250)
Name: NF19906_high_67
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 82 - 143
Target Start/End: Original strand, 7292944 - 7293005
Alignment:
| Q |
82 |
gaaaaatagacttctcaatcaaattatattgaaggaatttacacgggacatgtgatgtatat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7292944 |
gaaaaatagacttctcaatcaaattatattgaaggaatttacacgggacatgtgatgtatat |
7293005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 7316596 - 7316636
Alignment:
| Q |
82 |
gaaaaatagacttctcaatcaaattatattgaaggaattta |
122 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
7316596 |
gaaaaatagacttctaaatcaaattgtattgaaggaattta |
7316636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University