View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_68 (Length: 250)
Name: NF19906_high_68
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 27436050 - 27436287
Alignment:
| Q |
1 |
tctctgtcgacttggcattctcgatgccgaacgatagagaagatccaataatccagcaggtggtcgacaagggaggagctgagtatcaatttaatgaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27436050 |
tctctgtcgacttggcattctcgatgccgaaggatagagaagatccaataatccagcaggtggtcgataagggaggagctgagtatcaatttaatgaatt |
27436149 |
T |
 |
| Q |
101 |
caagcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaatgtcttcaagtctaaccttcaccgtgctaagagacatgggata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27436150 |
caagcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaacgtcttcaagtctaaccttcaccgtgctaagagacatgggata |
27436249 |
T |
 |
| Q |
201 |
atggatccttccgcaactcatggtgttacaagattctc |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27436250 |
atggatccttcagcaactcatggtgttacaagattctc |
27436287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 3 - 238
Target Start/End: Original strand, 27944544 - 27944779
Alignment:
| Q |
3 |
tctgtcgacttggcattctcgatgccgaacgatagagaagatccaataatccagcaggtggtcgacaagggaggagctgagtatcaatttaatgaattca |
102 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27944544 |
tctgtcgacttggcattctcgacgccaaacgaccgagaagatccaataatccagcaggtggtcgataagggaggagctgagtatcaatttaatgaattca |
27944643 |
T |
 |
| Q |
103 |
agcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaatgtcttcaagtctaaccttcaccgtgctaagagacatgggataat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27944644 |
agcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaatgtcttcaagtctaaccttcaccgtgctaagagacatgggataat |
27944743 |
T |
 |
| Q |
203 |
ggatccttccgcaactcatggtgttacaagattctc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27944744 |
ggatccttcagcaactcatggtgttacaagattctc |
27944779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 238
Target Start/End: Complemental strand, 27550184 - 27549949
Alignment:
| Q |
3 |
tctgtcgacttggcattctcgatgccgaacgatagagaagatccaataatccagcaggtggtcgacaagggaggagctgagtatcaatttaatgaattca |
102 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
27550184 |
tctgtcgacttggcattctcgacgccaaacgaccgagaagatccaataatccagcaggtggtcgataagggaggagctgagcatcaatttaatgaattca |
27550085 |
T |
 |
| Q |
103 |
agcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaatgtcttcaagtctaaccttcaccgtgctaagagacatgggataat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27550084 |
agcaaaggtttggtaaggtttattcctccaaagatgaacatgattataggttcaacgtcttcaagtctaaccttcaccgtgctaagagacatgtgataat |
27549985 |
T |
 |
| Q |
203 |
ggatccttccgcaactcatggtgttacaagattctc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27549984 |
ggatccttcggcaactcatggtgttacaagattctc |
27549949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 110 - 238
Target Start/End: Original strand, 26764904 - 26765032
Alignment:
| Q |
110 |
gtttggtaaggtttattcctccaaagatgaacatgattataggttcaatgtcttcaagtctaaccttcaccgtgctaagagacatgggataatggatcct |
209 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||| ||||| || ||||||||||||| || ||||||||||||| ||| | ||||||||| |
|
|
| T |
26764904 |
gtttgggaaggtttattcttccaaggatgaacatgattacaggtttaaaatcttcaagtctaatctgaaccgtgctaagaggcatcaattgatggatcct |
26765003 |
T |
 |
| Q |
210 |
tccgcaactcatggtgttacaagattctc |
238 |
Q |
| |
|
|| || ||| ||||||||||||||||| |
|
|
| T |
26765004 |
tcggcggttcacggtgttacaagattctc |
26765032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University