View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_79 (Length: 239)
Name: NF19906_high_79
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_79 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 226211 - 225982
Alignment:
| Q |
1 |
gaagaaaggcccaggccggtaagttggttactatcacataacccattttaatcggtaattagacaaatatactggcagtgatagttttcaagcgacagac |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
226211 |
gaagaaaggccaaggccggtaagttggttactatcacataacccattttaatcggtaattagacgaatatactggcagtgatagttttcaagcgacagat |
226112 |
T |
|
| Q |
101 |
tattgtatactaggaatttaaaagataggtcacttttcctcgtgttgataccattacagcatacggtttggagtttgattagtgtacattaactt----- |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226111 |
tattgtatactaggaatttaaaagataggtcactttgcctcgtgttgataccattacagcatacggtttggagtttgattagtgtacattaacttacttc |
226012 |
T |
|
| Q |
196 |
-catatatacattttttcatactgacttgt |
224 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
226011 |
atatatatatattttttcatactgacttgt |
225982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University