View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_80 (Length: 237)
Name: NF19906_high_80
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 8984997 - 8984777
Alignment:
| Q |
4 |
gtgatttcttaaatctagatggaattaaatcatgggaaaggggatgtagctaggtatattttgcatgggaagcaacatttcatattggtgtttcttttat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8984997 |
gtgatttcttaaatctagatggaattaaatcatgggaaaggggatgtagctaggtatattttgcatgggaagcaacatttcatattggtgtttcttttat |
8984898 |
T |
 |
| Q |
104 |
ggttgggaaggtcgtactccaggtgaaacgtcaatatgtggtcacacatataggtttgtttcaaagcttaagttgaacatactatatgcctatcaaacat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8984897 |
ggttgggaaggtcgtactccaggtgaaacgtcaatatgtggtcacacatataggtttgtttcaaagcttaagttgaacatactatatgcctagcaaacat |
8984798 |
T |
 |
| Q |
204 |
actatgtataggttgttttga |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8984797 |
actatgtataggttgttttga |
8984777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University