View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_high_83 (Length: 234)
Name: NF19906_high_83
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_high_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 25998617 - 25998817
Alignment:
| Q |
18 |
agagtagccaagagaatgagttagaagcaacacaatgagcacaagcttcgggttatatttataagtcgttaatgacacaacacacaagtcatagggcaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
25998617 |
agagtagccaagagaatgagttagaagcaacacaatgagcacaagcttcgggttatatttataagtcgttaatgacaca--acataagtcatagggcaca |
25998714 |
T |
 |
| Q |
118 |
tttataatatgagattaattgtagaacaagnnnnnnnnctaaagggaatgaatggattcattactacaaaacacgtgttttcctagcaacagctgttata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25998715 |
tttataatatgagattaattgtagaacaag-tttttttctaaagggaatgaatggattcattactacaaaacacgtgttttcctagcaacagctgttata |
25998813 |
T |
 |
| Q |
218 |
tgtg |
221 |
Q |
| |
|
|||| |
|
|
| T |
25998814 |
tgtg |
25998817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University