View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_57 (Length: 281)
Name: NF19906_low_57
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 142 - 275
Target Start/End: Complemental strand, 49328036 - 49327905
Alignment:
| Q |
142 |
gttcctaatgaataaaaacaacagctcaatatagttttattagttgtcatgttttatgagtagaaatcaaatttggtactcatataccttgcatatcaac |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49328036 |
gttcttaatgaataaaaacaacagctcaata--gttttattagttgtcatgttttatgagtagaaatcaaatttggtactcatataccttgcatatcaac |
49327939 |
T |
 |
| Q |
242 |
catttgtgactgattctctagtgatattcttcga |
275 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |
|
|
| T |
49327938 |
catttgtgactgattctctagtggtatttttcga |
49327905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 49328159 - 49328075
Alignment:
| Q |
17 |
tcgactgtctagctaaatatggaactcgtgcaatgattgttttcgtctattataagttgattgattctcctatatagttgattga |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49328159 |
tcgactgtccagctaaatatggaactcgtgcaatgattgttttcgtctattataagttgattgattctcctatatagttgattga |
49328075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University