View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_74 (Length: 249)
Name: NF19906_low_74
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 23802921 - 23803160
Alignment:
| Q |
1 |
acaccgcctttagcagcatgcacaccgagccaaggtgtgtgacgccaagcaatagtgccattactaccagcaagaaccttttggccaccaacaacaatct |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23802921 |
acaccacctttagcagcatgcacaccgagccaaggtgtgtgacgccaagcaatagtgccgttactaccagcaagaaccttttggccaccaacaacaatct |
23803020 |
T |
|
| Q |
101 |
ctatctgccaattatcaggaaccatttgccacatcacaaaacaccctttttctgatgttccattaacaccaccaccaccgacggatccaagctcgtccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23803021 |
ctatctgccaattatcaggaaccatttgccacatcacaaaacaccctttttctgatgttccattaacaccaccactaccgacggatccaagctcgtccac |
23803120 |
T |
|
| Q |
201 |
gacaaccattgtcacttttccggttgcaaacacattcttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23803121 |
gacaaccattgtcacttttccggttgcaaacacattcttc |
23803160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University