View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_75 (Length: 248)
Name: NF19906_low_75
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 17125193 - 17125390
Alignment:
| Q |
17 |
aggggtaacttgaagaggggaactgaactctgcacttgacaaagaacaaacaatgccatcattgtttatctgttcttcacaagatgagaatatgtctgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17125193 |
aggggtaacttgaagaggggaactgaactctgcacttgacaaggaacaaacaatgccatcattgtttatctgttcttcacaagatgagaatatatctgct |
17125292 |
T |
 |
| Q |
117 |
acaaaaagataaat-----attagcaattctgattcgttgagatttgagacgttagcaaattagcatataaaagattttatcttttgaggaagttgaa |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17125293 |
acaaaaagataaatatctaattagcaattctgattcgttgagatttgagacgttagcaaattagcatataaaagattttatcttttgaggaagttgaa |
17125390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University