View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_77 (Length: 247)
Name: NF19906_low_77
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_77 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 247
Target Start/End: Complemental strand, 20322293 - 20322208
Alignment:
| Q |
162 |
ttgatactaggagatccatcagtggtcagtgtatcttcttagagaattatctcatttcatggagaacaaagaaacaagtaactgtt |
247 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| | ||||||| ||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20322293 |
ttgatactaggagatccattagtggtcaatgttttttcttagggaattctctcatttcatggagaacaaagaaacaagtgactgtt |
20322208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 240
Target Start/End: Complemental strand, 32610958 - 32610883
Alignment:
| Q |
165 |
atactaggagatccatcagtggtcagtgtatcttcttagagaattatctcatttcatggagaacaaagaaacaagt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||| | | | |||||||||||||||||||||||||| |
|
|
| T |
32610958 |
atactaggagatccatcagtggtcagtgtttcttcttagggaactctttaatttcatggagaacaaagaaacaagt |
32610883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University