View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_84 (Length: 236)
Name: NF19906_low_84
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 25 - 219
Target Start/End: Complemental strand, 11645370 - 11645178
Alignment:
| Q |
25 |
ttgagggaaacgactcgtgtgaccttgtgaagaaccaaaatgtctgttacaaacctttacaatttcttaaactatcctttctcaataatgttggcttttc |
124 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
11645370 |
ttgagggaaacgactcgtgtgacct-gtgaagaaccaaaatgattgttacaaacctttacaatttcttaaactatcctttgtcattgatgttggcttttc |
11645272 |
T |
 |
| Q |
125 |
tttttgttaaatcagtgagtttagccaaaacacgtgcaactttgcaaagggcatcgataacactacaatgtcgtaactaaaatctggcttgattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11645271 |
tttttgttaaatcagtgagtttagcc-aaacacgtgcaactttgcaaagggcatcgatgacactacaatggcgtaactaaaatctggcttgattt |
11645178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University