View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_87 (Length: 234)
Name: NF19906_low_87
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 40644509 - 40644725
Alignment:
| Q |
1 |
tatgatccaacatctggttcataacaatatttgcaagccgataaagatttt-ttgtgaaggtcctaatttctctcacctcttatttgctaatggatgcat |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40644509 |
tatgatccaacatccggttcataacaatatttgcaagccgataaagatttttttgtgaaggtcctaatttctctcacctcttatttgctaatggatgcat |
40644608 |
T |
|
| Q |
100 |
tctctttactaaagacaaaggctctccagttaagttggttcgagatgtgctgcaannnnnnnnatatgtttcatgattcaagatcaatttaagaattcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40644609 |
tctctttactaaagacaaaggctctccagttaagttggttcgagatgtgctgcaaatttttttatatgtttcatgattcaagatcaatttcagaattcaa |
40644708 |
T |
|
| Q |
200 |
agtttatgacctcttca |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40644709 |
agtttatgacctcttca |
40644725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 12670766 - 12670919
Alignment:
| Q |
1 |
tatgatccaacatctggttcataacaatatttgcaagccgataaagattttttgtgaaggtcctaatttctctcacctcttatttgctaatggatgcatt |
100 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||| | ||||| |||||||||| | |||||||| || || ||||||| || |||||| | ||| | || |
|
|
| T |
12670766 |
tatggtccaacatcgggttaataacaatattaggaagccaataaagatttctcgtgaaggtgatagttactctcacttcctatttgttgatgacaacctt |
12670865 |
T |
|
| Q |
101 |
ctctttactaaagacaaaggctctccagttaagttggttcgagatgtgctgcaa |
154 |
Q |
| |
|
||||||||||| | |||| ||| || ||||||| |||| | |||||||| |||| |
|
|
| T |
12670866 |
ctctttactaatgccaaaagctttcaagttaaggtggtccaagatgtgcagcaa |
12670919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University