View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_88 (Length: 232)
Name: NF19906_low_88
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 66 - 222
Target Start/End: Complemental strand, 21656635 - 21656479
Alignment:
| Q |
66 |
tagggtggatattttataaaatttaccctatcatgcattggtgtcttatacacgtaaaatgcaagatagtgtttttaaaggcacatgtcaattatagatt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
21656635 |
tagggtggatattttataaaatttaccctatcatgcattggtgtcttatacacataaaatgcaagataatgtttttaaaggcacgtgtcaattatagatt |
21656536 |
T |
|
| Q |
166 |
actaatttcatatcacttgtgctatggtctcaatatgattactaatttcatctcact |
222 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
21656535 |
actaatttcatatcacttttactatggtctcaataagattactaatttcatatcact |
21656479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 189
Target Start/End: Complemental strand, 21656500 - 21656472
Alignment:
| Q |
161 |
agattactaatttcatatcacttgtgcta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21656500 |
agattactaatttcatatcacttgtgcta |
21656472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 5946201 - 5946229
Alignment:
| Q |
20 |
attctttcataggtaccctagttgtcacc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5946201 |
attctttcataggtaccctagttgtcacc |
5946229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 41949538 - 41949566
Alignment:
| Q |
20 |
attctttcataggtaccctagttgtcacc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41949538 |
attctttcataggtaccctagttgtcacc |
41949566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University