View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_94 (Length: 203)
Name: NF19906_low_94
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_94 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 3864169 - 3864005
Alignment:
| Q |
14 |
cacagagacatatggagagtgtaatgggaaaccaatgaaaaaagataggaattgttgttgttattttgtatataaaggatggaataacattcctagagta |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3864169 |
cacaaagacatatggagagtgtaatgggaaaccaatgaaaaaagataggaattgttgttgttat---------aaaggatggaataacattcctagagta |
3864079 |
T |
|
| Q |
114 |
tatgcctaacccaaatagtggaaggaagggactgaggtactctttatgctgaagttgtatgtagttacgtacct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3864078 |
tatgcctaacccaaatagtggaaggaaggaactgaggtactctttatgctgaagttgtatgtagttacgtacct |
3864005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University