View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19906_low_95 (Length: 203)
Name: NF19906_low_95
Description: NF19906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19906_low_95 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 80 - 203
Target Start/End: Original strand, 33088914 - 33089037
Alignment:
| Q |
80 |
tggttttatcatggacaaaaggtagtagggttttccgtcgtgcaagaaaaggaaaagagttactatcaaattcatgcaacgatttacaagtggagatagc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33088914 |
tggttttatcatggacaaaaggtagtagggttttccgtcgtgcaagaaaaggaaaagagttactatcaaattcatgcaacgatttacaagtggagatagc |
33089013 |
T |
|
| Q |
180 |
aattccaactcattttcgttgtcc |
203 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33089014 |
aattccaactcattttcgttgtcc |
33089037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University