View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19907_high_13 (Length: 202)
Name: NF19907_high_13
Description: NF19907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19907_high_13 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 173
Target Start/End: Complemental strand, 6450 - 6294
Alignment:
| Q |
17 |
taggtagatcaactttaggtgtctcgatggaaggacttgcaatatgttcatttacaagagatgcatgctcactcttcaacgtttcaaaatcatttttaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6450 |
taggtagatcaactttaggtgtctcgatgggaggacttgcaatatgttcatttacaagagatgcatgctcactcttcaacgtttcaaaatcatttttaac |
6351 |
T |
|
| Q |
117 |
ttttaagattttggcttgcaatgtgagaataaccctcttttgcgtccctattttctt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6350 |
ttttaagattttggcttgcaatgtgagaataaccctcttttgcatccctattttctt |
6294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University