View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19907_high_8 (Length: 258)
Name: NF19907_high_8
Description: NF19907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19907_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 42069575 - 42069814
Alignment:
| Q |
18 |
gttgattgataaacctaactgcccttgctagggatcttggaatttctataaaataatgannnnnnnnatataaattaaagttgtggtcacatgtctctct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42069575 |
gttgattgataaacctaactgcccttgctagggatcttggaatttctataaaataatgattttttg-atataaattaaagttgtggtcacatgtctctct |
42069673 |
T |
|
| Q |
118 |
acctacgaattcattacacaattctattgtcctgcgtggaattccatttcaaattatatatataaaaggataccatgctccaagaaaaatattgttctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069674 |
acctacgaattcattacacaattctattgtcctgcgtggaattccatttccaattatatatataaaaggataccatgctccaagaaaaatattgttctct |
42069773 |
T |
|
| Q |
218 |
ccaagttcaaaaatactccatacctatggggacttgtattt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069774 |
ccaagttcaaaaatactccatacctatggggacttgtattt |
42069814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University