View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19907_high_9 (Length: 250)
Name: NF19907_high_9
Description: NF19907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19907_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 1707888 - 1708128
Alignment:
| Q |
1 |
cttcaaatttgatttgttttacatttcttcttgttttgttttggagaggattgttttacacttaaatatagtagttgtccacatatcacatatcttactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1707888 |
cttcaaatttgatttgttttacatttcttcttgttttgttttggagaggattgttttacacttaaatatagtagttgtccacatatcacatatcttactg |
1707987 |
T |
 |
| Q |
101 |
tggttgagaaaatatccaataatagcataatcattgtattaaatttttgtcctttttcaacgggatgagtttggaccatgaaaacggacttgctctgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1707988 |
tggttgagaaaatatccaataatagcataatcattgtattaaatttttgtcctttttcaacgggatgagtttggaccatgaaaacggacttgctctgtct |
1708087 |
T |
 |
| Q |
201 |
gggtccacttagcaaaaatcagactattgtattgttcttatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1708088 |
gggtccacttagcaaaaatcagactatt-tattgttcttatc |
1708128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University