View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19907_low_10 (Length: 250)

Name: NF19907_low_10
Description: NF19907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19907_low_10
NF19907_low_10
[»] chr3 (1 HSPs)
chr3 (1-242)||(1707888-1708128)


Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 1707888 - 1708128
Alignment:
1 cttcaaatttgatttgttttacatttcttcttgttttgttttggagaggattgttttacacttaaatatagtagttgtccacatatcacatatcttactg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1707888 cttcaaatttgatttgttttacatttcttcttgttttgttttggagaggattgttttacacttaaatatagtagttgtccacatatcacatatcttactg 1707987  T
101 tggttgagaaaatatccaataatagcataatcattgtattaaatttttgtcctttttcaacgggatgagtttggaccatgaaaacggacttgctctgtct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1707988 tggttgagaaaatatccaataatagcataatcattgtattaaatttttgtcctttttcaacgggatgagtttggaccatgaaaacggacttgctctgtct 1708087  T
201 gggtccacttagcaaaaatcagactattgtattgttcttatc 242  Q
    |||||||||||||||||||||||||||| |||||||||||||    
1708088 gggtccacttagcaaaaatcagactatt-tattgttcttatc 1708128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University