View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19909_high_27 (Length: 274)
Name: NF19909_high_27
Description: NF19909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19909_high_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 274
Target Start/End: Complemental strand, 2897320 - 2897061
Alignment:
| Q |
13 |
aatattaggcttttattagtagcaagagtgggnnnnnnnntagctccccaaatattttccatccattatcttgtttgaatatcttttatctcnnnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2897320 |
aatattaggcttttattagtagcaagagtgggaaaaaaa-tagctccccaaatattttccatccgttatcttgtttgaatatcttttatctcttttttac |
2897222 |
T |
 |
| Q |
113 |
nnnnngtctgttataatttatatgtaatttgatgtccttgttatgaattgaaactttttccttgtatttttaattacagaattatcagtaatgcattgat |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2897221 |
tttttatcttttataatttatatgtaatttgatgtccttgttatgaattgaaactttttccttgtatttttaattacagaattatcagtaatgcattgat |
2897122 |
T |
 |
| Q |
213 |
aaacattannnnnnnataaataaattgttataaaaatcaaaggagaactatttaattttctt |
274 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2897121 |
aaacatt-tttttaaaaaaataaatttttataaaaatcaaaggagaactatttaattttctt |
2897061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University