View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19909_high_38 (Length: 229)
Name: NF19909_high_38
Description: NF19909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19909_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 13400524 - 13400321
Alignment:
| Q |
13 |
aatatgattttaaaaaatgaaactcatttaataatcaactaggattcttcnnnnnnnnnnn--tcaactaagattgattatcttcattcgtgctggcata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13400524 |
aatatgattttaaaaaatgaaactcatttaataatcaactaggattcttcaaaaaaaaaaaaatcaactaagattgattatcttcattcgtgctggcata |
13400425 |
T |
|
| Q |
111 |
gatagtggtaatttctaactgcatttagtgtggtccaggcagacaaatttcagaaattgtatttactttatccatttaaatgtatacaatatctgattac |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13400424 |
gatagtggtaatttctaactgcttttagtgtggtccaggcagacaaatttcagaaattgtatttactttatccatttaaatgtatacaatatctgattac |
13400325 |
T |
|
| Q |
211 |
tatc |
214 |
Q |
| |
|
|||| |
|
|
| T |
13400324 |
tatc |
13400321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University