View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19909_low_32 (Length: 250)
Name: NF19909_low_32
Description: NF19909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19909_low_32 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 47550828 - 47551059
Alignment:
| Q |
16 |
atcgaaataatttcttttttcaaccaacttttaataatccaatgtccagtcatgatatgagaggagacaataatgggttgggaggcattatttcttcagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47550828 |
atcgaaataatttcttttttcaaccaacttttaataatccaatgtccagtcatgatatgagaggagacaataatgggttgggaggcattatttcttcagt |
47550927 |
T |
 |
| Q |
116 |
tgaaagtgtgcagaagaacaccgcagcaggatggaacaagataggaacaacaaattccctgccgcggcgggtggatagctttgatcatcaactggattct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47550928 |
tgaaagtgtgcagaagaacaccgcagcaggatcgaacaagatagaaacaacaaattccctgcc---gcgggtggatagctttgatcatcaactggattct |
47551024 |
T |
 |
| Q |
216 |
ttttgtcgtgatgcaatgctgaagaagaaaagtga |
250 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| |
|
|
| T |
47551025 |
ttttgtggtgatgcaatgctgaagaagacaagtga |
47551059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 57 - 178
Target Start/End: Original strand, 47529011 - 47529129
Alignment:
| Q |
57 |
atgtccagtcatgatatgagaggagacaataatgggttgggaggcattatttcttcagttgaaagtgtgcagaagaacaccgcagcaggatggaacaaga |
156 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| | | |||| ||||||||||||||| |||||||| || |||||||| ||||||| ||||||||| |
|
|
| T |
47529011 |
atgtccagtcatgatatgagaggagccaataatagatcgggaagcattatttcttcagctgaaagtgggc---agaacaccccagcaggtgggaacaaga |
47529107 |
T |
 |
| Q |
157 |
taggaacaacaaattccctgcc |
178 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
47529108 |
taggacgaacaaattccctgcc |
47529129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University