View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19909_low_36 (Length: 237)

Name: NF19909_low_36
Description: NF19909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19909_low_36
NF19909_low_36
[»] chr4 (3 HSPs)
chr4 (71-211)||(51303494-51303635)
chr4 (149-211)||(5204466-5204528)
chr4 (83-211)||(9536153-9536282)
[»] chr2 (1 HSPs)
chr2 (1-210)||(35061646-35061856)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 71 - 211
Target Start/End: Complemental strand, 51303635 - 51303494
Alignment:
71 tttctccgcaatgttatggcaccacttaggtttcaccaatcttgatttcttctcttctactgatgcttac-agtggcttaaaggggaaactaagggttcc 169  Q
    |||||| || |||||||||||||||||||||||||| |||| ||| ||||||||||||| |||||||||| ||||||||||||||| |||||||||||||    
51303635 tttctctgctatgttatggcaccacttaggtttcactaatcctgaattcttctcttctattgatgcttacgagtggcttaaagggggaactaagggttcc 51303536  T
170 catgctatcactttttctgtcggagtttggtggtcttggcga 211  Q
    |||||||||||||||||||||||||||||||| |||||||||    
51303535 catgctatcactttttctgtcggagtttggtgatcttggcga 51303494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 5204528 - 5204466
Alignment:
149 aaaggggaaactaagggttcccatgctatcactttttctgtcggagtttggtggtcttggcga 211  Q
    ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
5204528 aaagggggaactaagggttcccatgctatcactttttatgtcggagtttggtggtcttggcga 5204466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 83 - 211
Target Start/End: Original strand, 9536153 - 9536282
Alignment:
83 gttatggcaccacttaggtttcaccaatcttgatttcttctcttctactgatgcttac-agtggcttaaaggggaaactaagggttcccatgctatcact 181  Q
    ||||||| |||||||||||||||| |||   ||||  || ||||||| ||||| |||| | ||||||| |  || | ||||||||||  | |||||||||    
9536153 gttatggaaccacttaggtttcactaatgcggattctttttcttctattgatgtttacgaatggcttagaaagggagctaagggttcttaggctatcact 9536252  T
182 ttttctgtcggagtttggtggtcttggcga 211  Q
    || ||||| |||||||||||||||||||||    
9536253 ttctctgttggagtttggtggtcttggcga 9536282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35061856 - 35061646
Alignment:
1 ctccttcggctacttgctctcgctgcggtctttaaaatgagacctttatacattgtgttcgtgactttactttctccgcaatgttatggcaccacttagg 100  Q
    ||||||| |||||||||||||| ||| ||||  | || || |||||| | |||||||||| ||||| |||||||||| |  |||||||||||||||||||    
35061856 ctccttctgctacttgctctcgttgccgtctccagaacgatacctttctccattgtgttcatgactgtactttctccactttgttatggcaccacttagg 35061757  T
101 tttcaccaatcttgatttcttctcttctactgatgctta-cagtggcttaaaggggaaactaagggttcccatgctatcactttttctgtcggagtttgg 199  Q
    |||||| |||| |||||| ||||||| ||  ||||||||  | |||||||   ||| | |||||||||| || |||| |||||||||||| |||||||||    
35061756 tttcactaatcatgattttttctcttttatggatgcttatgattggcttaggaggggagctaagggttctcaggctaacactttttctgtgggagtttgg 35061657  T
200 tggtcttggcg 210  Q
    |||||||||||    
35061656 tggtcttggcg 35061646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University