View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19909_low_44 (Length: 222)
Name: NF19909_low_44
Description: NF19909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19909_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 51738594 - 51738407
Alignment:
| Q |
19 |
atgtaacaataagcaaaggaaaacatagtaaaattttcttataacttgtgagtgatttctaaaataatagaattatatgaaacacaaggccatgcgcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51738594 |
atgtaacaataagcaaaggaaaacatagtaaaattttcttataatttgtgagtgatttctaaaataatagaattatatgaaacacaaggccatgcgcttt |
51738495 |
T |
|
| Q |
119 |
gtcatgtgtgtgcctgcaacgcatgggggcgtatgggcactaaaaaccctttaagaaacgttttctttttgcatttatgagaaatttt |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51738494 |
gtcatgtgtgtgcctgcagcgcatgggggcgtatgggcactagaaaccctttaagaaacgttttctttttgcatttatgagaaatttt |
51738407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University